EMAIL THIS PAGE TO A FRIEND

INO80D

INO80 complex subunit D

Gene ID:
Mouse(227195) INO80 complex subunit D
Rat(316440) INO80 complex subunit D
sheep(101115188) INO80 complex subunit D
Domestic Rabbit(100340146) INO80 complex subunit D
domestic guinea pig(100716387) INO80 complex subunit D
naked mole-rat(101717660) INO80 complex subunit D
chicken(424103) INO80 complex subunit D
domestic cat(101100499) INO80 complex subunit D
cow(527199) INO80 complex subunit D
dog(488489) INO80 complex subunit D
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017759 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081436 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081436 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081436 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017759 Rosetta Predictions human pricing
XM_001070910 Rosetta Predictions rat pricing
XM_237220 Rosetta Predictions rat pricing
NM_001081436 Rosetta Predictions mouse pricing
NM_001114609 Rosetta Predictions mouse pricing
XM_110350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164424 predicted 2941
2 SASI_Hs01_00164425 predicted 1812
3 SASI_Hs02_00350581 predicted 3074
4 SASI_Hs01_00164426 predicted 1523
5 SASI_Hs01_00164427 predicted 1592
6 SASI_Hs02_00350582 predicted 2990
7 SASI_Hs01_00164428 predicted 488
8 SASI_Hs01_00164429 predicted 2882
9 SASI_Hs01_00164432 predicted 1471
10 SASI_Hs01_00164430 predicted 1601
11 SASI_Hs01_00164431 predicted 2190
12 SASI_Hs01_00164433 predicted 2892
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333249 predicted 1426
2 SASI_Rn02_00333250 predicted 1216
3 SASI_Rn02_00333251 predicted 1672
4 SASI_Rn02_00333252 predicted 1795
5 SASI_Rn02_00333253 predicted 1492
6 SASI_Rn02_00333254 predicted 1347
7 SASI_Rn02_00333255 predicted 1303
8 SASI_Rn02_00333256 predicted 1055
9 SASI_Rn02_00333257 predicted 2105
10 SASI_Rn02_00333258 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237220 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390767 predicted 1427
2 SASI_Rn02_00390768 predicted 1215
3 SASI_Rn02_00390769 predicted 1677
4 SASI_Rn02_00390770 predicted 1795
5 SASI_Rn02_00390771 predicted 1489
6 SASI_Rn02_00390772 predicted 1346
7 SASI_Rn02_00390773 predicted 1309
8 SASI_Rn02_00390774 predicted 1050
9 SASI_Rn02_00390775 predicted 2108
10 SASI_Rn02_00390776 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081436 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298361 predicted 1214
2 SASI_Mm02_00298362 predicted 1292
3 SASI_Mm02_00298363 predicted 1659
4 SASI_Mm02_00298364 predicted 1509
5 SASI_Mm02_00298365 predicted 2053
6 SASI_Mm02_00298366 predicted 2715
7 SASI_Mm02_00298367 predicted 1975
8 SASI_Mm02_00298368 predicted 2608
9 SASI_Mm02_00298369 predicted 706
10 SASI_Mm02_00298370 predicted 2324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114609 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308707 predicted 1309
2 SASI_Mm02_00308708 predicted 1381
3 SASI_Mm02_00308709 predicted 1751
4 SASI_Mm02_00308710 predicted 1600
5 SASI_Mm02_00308711 predicted 2143
6 SASI_Mm02_00308712 predicted 2797
7 SASI_Mm02_00308713 predicted 2062
8 SASI_Mm02_00308714 predicted 2700
9 SASI_Mm02_00308715 predicted 801
10 SASI_Mm02_00308716 predicted 2419
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_110350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230779 predicted 1372
2 SASI_Mm01_00230780 predicted 1457
3 SASI_Mm01_00230781 predicted 1818
4 SASI_Mm01_00230782 predicted 1669
5 SASI_Mm01_00230783 predicted 2211
6 SASI_Mm01_00230784 predicted 483
7 SASI_Mm01_00230785 predicted 366
8 SASI_Mm01_00230786 predicted 2131
9 SASI_Mm01_00230787 predicted 1529
10 SASI_Mm01_00230788 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017759
VALIDATED
INO80D MISSION shRNA Bacterial Glycerol Stock
INO80 complex subunit D
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017759.2-854s1c1
Sequence:CCGGCCATTTGCTTTCAATGAGGAACTCGAGTTCCTCATTGAAAGCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017759.2-2949s1c1
Sequence:CCGGCAACATCGTACTCTGGTGATACTCGAGTATCACCAGAGTACGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017759.2-2549s1c1
Sequence:CCGGGAGCTATTGAATGGGCGTATACTCGAGTATACGCCCATTCAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017759.2-2552s1c1
Sequence:CCGGCTATTGAATGGGCGTATAGTACTCGAGTACTATACGCCCATTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017759.2-1530s1c1
Sequence:CCGGGCACTTACTTTCAGCAGAAATCTCGAGATTTCTGCTGAAAGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-1960s21c1
Sequence:CCGGAGAGGAGATAACTCCCGTAAACTCGAGTTTACGGGAGTTATCTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017759.4-3799s21c1
Sequence:CCGGATACCAGTGCCCTTTACTATTCTCGAGAATAGTAAAGGGCACTGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017759.4-3868s21c1
Sequence:CCGGTAGGTGGTTCTAGATAGAATGCTCGAGCATTCTATCTAGAACCACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-2814s21c1
Sequence:CCGGGAGCAAGGCAGATGACCTAATCTCGAGATTAGGTCATCTGCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-446s21c1
Sequence:CCGGATAAGCCCTTGTGCTCATATACTCGAGTATATGAGCACAAGGGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-1763s21c1
Sequence:CCGGGTGAACAGTGCGCTAACAAAGCTCGAGCTTTGTTAGCGCACTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-826s21c1
Sequence:CCGGCACTACCTGGAAACCGAATTGCTCGAGCAATTCGGTTTCCAGGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-558s21c1
Sequence:CCGGTGAATATGTGGCCAAGTATAACTCGAGTTATACTTGGCCACATATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-1593s21c1
Sequence:CCGGGAAATGCCGGCATACGTTTAGCTCGAGCTAAACGTATGCCGGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017759
VALIDATED
INO80D MISSION shRNA shRNA Plasmid DNA
INO80 complex subunit D
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017759.2-854s1c1
Sequence:CCGGCCATTTGCTTTCAATGAGGAACTCGAGTTCCTCATTGAAAGCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017759.2-2949s1c1
Sequence:CCGGCAACATCGTACTCTGGTGATACTCGAGTATCACCAGAGTACGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017759.2-2549s1c1
Sequence:CCGGGAGCTATTGAATGGGCGTATACTCGAGTATACGCCCATTCAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017759.2-2552s1c1
Sequence:CCGGCTATTGAATGGGCGTATAGTACTCGAGTACTATACGCCCATTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017759.2-1530s1c1
Sequence:CCGGGCACTTACTTTCAGCAGAAATCTCGAGATTTCTGCTGAAAGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-1960s21c1
Sequence:CCGGAGAGGAGATAACTCCCGTAAACTCGAGTTTACGGGAGTTATCTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017759.4-3799s21c1
Sequence:CCGGATACCAGTGCCCTTTACTATTCTCGAGAATAGTAAAGGGCACTGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017759.4-3868s21c1
Sequence:CCGGTAGGTGGTTCTAGATAGAATGCTCGAGCATTCTATCTAGAACCACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-2814s21c1
Sequence:CCGGGAGCAAGGCAGATGACCTAATCTCGAGATTAGGTCATCTGCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-446s21c1
Sequence:CCGGATAAGCCCTTGTGCTCATATACTCGAGTATATGAGCACAAGGGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-1763s21c1
Sequence:CCGGGTGAACAGTGCGCTAACAAAGCTCGAGCTTTGTTAGCGCACTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-826s21c1
Sequence:CCGGCACTACCTGGAAACCGAATTGCTCGAGCAATTCGGTTTCCAGGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-558s21c1
Sequence:CCGGTGAATATGTGGCCAAGTATAACTCGAGTTATACTTGGCCACATATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-1593s21c1
Sequence:CCGGGAAATGCCGGCATACGTTTAGCTCGAGCTAAACGTATGCCGGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017759
VALIDATED
INO80D MISSION shRNA Lentiviral Transduction Particles
INO80 complex subunit D
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017759.2-854s1c1
Sequence:CCGGCCATTTGCTTTCAATGAGGAACTCGAGTTCCTCATTGAAAGCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017759.2-2949s1c1
Sequence:CCGGCAACATCGTACTCTGGTGATACTCGAGTATCACCAGAGTACGATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149662    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017759.2-2549s1c1
Sequence:CCGGGAGCTATTGAATGGGCGTATACTCGAGTATACGCCCATTCAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_017759.2-2552s1c1
Sequence:CCGGCTATTGAATGGGCGTATAGTACTCGAGTACTATACGCCCATTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_017759.2-1530s1c1
Sequence:CCGGGCACTTACTTTCAGCAGAAATCTCGAGATTTCTGCTGAAAGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-1960s21c1
Sequence:CCGGAGAGGAGATAACTCCCGTAAACTCGAGTTTACGGGAGTTATCTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017759.4-3799s21c1
Sequence:CCGGATACCAGTGCCCTTTACTATTCTCGAGAATAGTAAAGGGCACTGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429203    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017759.4-3868s21c1
Sequence:CCGGTAGGTGGTTCTAGATAGAATGCTCGAGCATTCTATCTAGAACCACCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-2814s21c1
Sequence:CCGGGAGCAAGGCAGATGACCTAATCTCGAGATTAGGTCATCTGCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-446s21c1
Sequence:CCGGATAAGCCCTTGTGCTCATATACTCGAGTATATGAGCACAAGGGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-1763s21c1
Sequence:CCGGGTGAACAGTGCGCTAACAAAGCTCGAGCTTTGTTAGCGCACTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-826s21c1
Sequence:CCGGCACTACCTGGAAACCGAATTGCTCGAGCAATTCGGTTTCCAGGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-558s21c1
Sequence:CCGGTGAATATGTGGCCAAGTATAACTCGAGTTATACTTGGCCACATATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017759.4-1593s21c1
Sequence:CCGGGAAATGCCGGCATACGTTTAGCTCGAGCTAAACGTATGCCGGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081436
VALIDATED
INO80D MISSION shRNA Bacterial Glycerol Stock
INO80 complex subunit D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081436.2-5905s21c1
Sequence:CCGGTCAATAGTAGGTGGGTATTAACTCGAGTTAATACCCACCTACTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081436.2-2169s21c1
Sequence:CCGGTCGAGTGCCTGAGTACAATTGCTCGAGCAATTGTACTCAGGCACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081436.2-1182s21c1
Sequence:CCGGCAGATCAGGCTTCGCCATATCCTCGAGGATATGGCGAAGCCTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081436.2-1965s21c1
Sequence:CCGGATGAGTTGCCGGATGACATTGCTCGAGCAATGTCATCCGGCAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081436.2-1118s21c1
Sequence:CCGGGCGGACCTGTTTCCTCATTTACTCGAGTAAATGAGGAAACAGGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081436
VALIDATED
INO80D MISSION shRNA shRNA Plasmid DNA
INO80 complex subunit D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081436.2-5905s21c1
Sequence:CCGGTCAATAGTAGGTGGGTATTAACTCGAGTTAATACCCACCTACTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081436.2-2169s21c1
Sequence:CCGGTCGAGTGCCTGAGTACAATTGCTCGAGCAATTGTACTCAGGCACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081436.2-1182s21c1
Sequence:CCGGCAGATCAGGCTTCGCCATATCCTCGAGGATATGGCGAAGCCTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081436.2-1965s21c1
Sequence:CCGGATGAGTTGCCGGATGACATTGCTCGAGCAATGTCATCCGGCAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081436.2-1118s21c1
Sequence:CCGGGCGGACCTGTTTCCTCATTTACTCGAGTAAATGAGGAAACAGGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081436
VALIDATED
INO80D MISSION shRNA Lentiviral Transduction Particles
INO80 complex subunit D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081436.2-5905s21c1
Sequence:CCGGTCAATAGTAGGTGGGTATTAACTCGAGTTAATACCCACCTACTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081436.2-2169s21c1
Sequence:CCGGTCGAGTGCCTGAGTACAATTGCTCGAGCAATTGTACTCAGGCACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081436.2-1182s21c1
Sequence:CCGGCAGATCAGGCTTCGCCATATCCTCGAGGATATGGCGAAGCCTGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081436.2-1965s21c1
Sequence:CCGGATGAGTTGCCGGATGACATTGCTCGAGCAATGTCATCCGGCAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081436.2-1118s21c1
Sequence:CCGGGCGGACCTGTTTCCTCATTTACTCGAGTAAATGAGGAAACAGGTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks