EMAIL THIS PAGE TO A FRIEND

INPP5F

inositol polyphosphate-5-phosphatase F

Synonyms: MSTPO47 SAC2 hSAC2
Gene ID:
Human(22876) Summary: The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase and contains a Sac domain. The activity of this protein is specific for phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
Mouse(101490) inositol polyphosphate-5-phosphatase F
Rat(309008) inositol polyphosphate-5-phosphatase F
domestic guinea pig(100718453) inositol polyphosphate-5-phosphatase F
naked mole-rat(101708953) inositol polyphosphate-5-phosphatase F
sheep(101122650) inositol polyphosphate-5-phosphatase F
Zebrafish(570007) inositol polyphosphate-5-phosphatase F
cow(539889) inositol polyphosphate-5-phosphatase F
Horse(100065762) inositol polyphosphate-5-phosphatase F
chicken(423932) inositol polyphosphate-5-phosphatase F
dog(477842) inositol polyphosphate-5-phosphatase F
domestic cat(101094453) inositol polyphosphate-5-phosphatase F
115 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178641 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178641 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178641 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014937 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014937 Rosetta Predictions human pricing
NM_198330 Rosetta Predictions human pricing
NM_198331 Rosetta Predictions human pricing
NR_003251 Rosetta Predictions human pricing
NR_003252 Rosetta Predictions human pricing
NM_001107554 Rosetta Predictions rat pricing
NM_178641 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346602 predicted 554
2 SASI_Hs02_00346603 predicted 2109
3 SASI_Hs02_00346604 predicted 1819
4 SASI_Hs01_00182693 predicted 2799
5 SASI_Hs01_00182697 predicted 2808
6 SASI_Hs02_00346605 predicted 1910
7 SASI_Hs01_00182698 predicted 3420
8 SASI_Hs02_00346606 predicted 1305
9 SASI_Hs02_00346607 predicted 1640
10 SASI_Hs02_00346608 predicted 892
11 SASI_Hs01_00182690 predicted 2912
12 SASI_Hs01_00182691 predicted 3138
13 SASI_Hs01_00182692 predicted 2738
14 SASI_Hs01_00182694 predicted 3206
15 SASI_Hs01_00182695 predicted 2728
16 SASI_Hs01_00182696 predicted 3666
17 SASI_Hs01_00182699 predicted 3160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135253 predicted 1118
2 SASI_Hs01_00135254 predicted 1354
3 SASI_Hs01_00135255 predicted 941
4 SASI_Hs01_00135256 predicted 1023
5 SASI_Hs01_00135257 predicted 1418
6 SASI_Hs01_00135258 predicted 942
7 SASI_Hs01_00135259 predicted 1880
8 SASI_Hs01_00135260 predicted 1029
9 SASI_Hs01_00135261 predicted 1636
10 SASI_Hs01_00135262 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086670 predicted 555
2 SASI_Hs01_00086671 predicted 520
3 SASI_Hs01_00086672 predicted 463
4 SASI_Hs01_00086673 predicted 437
5 SASI_Hs01_00086674 predicted 400
6 SASI_Hs01_00086675 predicted 408
7 SASI_Hs01_00086676 predicted 374
8 SASI_Hs01_00086677 predicted 478
9 SASI_Hs01_00086678 predicted 546
10 SASI_Hs01_00086679 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378898 predicted 547
2 SASI_Hs02_00378899 predicted 718
3 SASI_Hs02_00378900 predicted 406
4 SASI_Hs02_00378901 predicted 373
5 SASI_Hs02_00378902 predicted 529
6 SASI_Hs02_00378903 predicted 464
7 SASI_Hs02_00378904 predicted 539
8 SASI_Hs02_00378905 predicted 565
9 SASI_Hs02_00378906 predicted 398
10 SASI_Hs02_00378907 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003252 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00378908 predicted 314
2 SASI_Hs02_00378909 predicted 941
3 SASI_Hs02_00378910 predicted 1018
4 SASI_Hs02_00378911 predicted 1413
5 SASI_Hs02_00378912 predicted 933
6 SASI_Hs02_00378913 predicted 350
7 SASI_Hs02_00378914 predicted 365
8 SASI_Hs02_00378915 predicted 1027
9 SASI_Hs02_00378916 predicted 1635
10 SASI_Hs02_00378917 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229975 predicted 1705
2 SASI_Rn02_00229976 predicted 1801
3 SASI_Rn02_00229977 predicted 2684
4 SASI_Rn02_00229978 predicted 2760
5 SASI_Rn02_00229979 predicted 2227
6 SASI_Rn02_00229980 predicted 3325
7 SASI_Rn02_00229981 predicted 3761
8 SASI_Rn02_00229982 predicted 2679
9 SASI_Rn02_00229983 predicted 435
10 SASI_Rn02_00229984 predicted 1900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169372 predicted 1937
2 SASI_Mm01_00169373 predicted 1657
3 SASI_Mm02_00349040 predicted 1159
4 SASI_Mm01_00169374 predicted 945
5 SASI_Mm01_00169375 predicted 358
6 SASI_Mm01_00169376 predicted 428
7 SASI_Mm01_00169377 predicted 1529
8 SASI_Mm01_00169379 predicted 2334
9 SASI_Mm01_00169380 predicted 1179
10 SASI_Mm01_00169381 predicted 2347
11 SASI_Mm01_00169378 predicted 3614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178641
VALIDATED
INPP5F MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-5-phosphatase F
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178641.5-3492s21c1
Sequence:CCGGGGGCTAACTCATGGGATAAACCTCGAGGTTTATCCCATGAGTTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178641.5-4033s21c1
Sequence:CCGGTAGTGTGCATTAGTATCTAAACTCGAGTTTAGATACTAATGCACACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178641.5-1092s21c1
Sequence:CCGGAGAGCAGGAATGCGGTATAAACTCGAGTTTATACCGCATTCCTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178641.5-3762s21c1
Sequence:CCGGAGTCTGAACCTTAGCAAATTTCTCGAGAAATTTGCTAAGGTTCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178641.3-4218s1c1
Sequence:CCGGGCAGGAATATAAGATCATGTTCTCGAGAACATGATCTTATATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178641.3-2031s1c1
Sequence:CCGGGCCAGCTCTTACAGAGTTATACTCGAGTATAACTCTGTAAGAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178641.3-1475s1c1
Sequence:CCGGCGAGGAATGAAGTTCGAGAATCTCGAGATTCTCGAACTTCATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178641.3-2174s1c1
Sequence:CCGGGCCTACTATGTGGCCTATTATCTCGAGATAATAGGCCACATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178641
VALIDATED
INPP5F MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-5-phosphatase F
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178641.5-3492s21c1
Sequence:CCGGGGGCTAACTCATGGGATAAACCTCGAGGTTTATCCCATGAGTTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178641.5-4033s21c1
Sequence:CCGGTAGTGTGCATTAGTATCTAAACTCGAGTTTAGATACTAATGCACACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178641.5-1092s21c1
Sequence:CCGGAGAGCAGGAATGCGGTATAAACTCGAGTTTATACCGCATTCCTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178641.5-3762s21c1
Sequence:CCGGAGTCTGAACCTTAGCAAATTTCTCGAGAAATTTGCTAAGGTTCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178641.3-4218s1c1
Sequence:CCGGGCAGGAATATAAGATCATGTTCTCGAGAACATGATCTTATATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178641.3-2031s1c1
Sequence:CCGGGCCAGCTCTTACAGAGTTATACTCGAGTATAACTCTGTAAGAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178641.3-1475s1c1
Sequence:CCGGCGAGGAATGAAGTTCGAGAATCTCGAGATTCTCGAACTTCATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178641.3-2174s1c1
Sequence:CCGGGCCTACTATGTGGCCTATTATCTCGAGATAATAGGCCACATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178641
VALIDATED
INPP5F MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-5-phosphatase F
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178641.5-3492s21c1
Sequence:CCGGGGGCTAACTCATGGGATAAACCTCGAGGTTTATCCCATGAGTTAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178641.5-4033s21c1
Sequence:CCGGTAGTGTGCATTAGTATCTAAACTCGAGTTTAGATACTAATGCACACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416876    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178641.5-1092s21c1
Sequence:CCGGAGAGCAGGAATGCGGTATAAACTCGAGTTTATACCGCATTCCTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419910    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178641.5-3762s21c1
Sequence:CCGGAGTCTGAACCTTAGCAAATTTCTCGAGAAATTTGCTAAGGTTCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178641.3-4218s1c1
Sequence:CCGGGCAGGAATATAAGATCATGTTCTCGAGAACATGATCTTATATTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178641.3-2031s1c1
Sequence:CCGGGCCAGCTCTTACAGAGTTATACTCGAGTATAACTCTGTAAGAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178641.3-1475s1c1
Sequence:CCGGCGAGGAATGAAGTTCGAGAATCTCGAGATTCTCGAACTTCATTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178641.3-2174s1c1
Sequence:CCGGGCCTACTATGTGGCCTATTATCTCGAGATAATAGGCCACATAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014937
VALIDATED
INPP5F MISSION shRNA Bacterial Glycerol Stock
inositol polyphosphate-5-phosphatase F
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014937.2-2120s21c1
Sequence:CCGGGCCTATTATGATGATGAAGTTCTCGAGAACTTCATCATCATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014937.2-3201s21c1
Sequence:CCGGCGCAATTAGATGTCTCTCTTTCTCGAGAAAGAGAGACATCTAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014937.2-3696s21c1
Sequence:CCGGAGTCGGAACCTGAGTAGATTTCTCGAGAAATCTACTCAGGTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014937.2-989s21c1
Sequence:CCGGCGATTTCTAGTGGCTCTCATTCTCGAGAATGAGAGCCACTAGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014937.2-481s21c1
Sequence:CCGGGCTCTGTAAGAAGCATCATTTCTCGAGAAATGATGCTTCTTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014937.2-3822s21c1
Sequence:GTACCGGACAGGTCACTTTGGGATATAACTCGAGTTATATCCCAAAGTGACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014937.2-3201s1c1
Sequence:CCGGCGCAATTAGATGTCTCTCTTTCTCGAGAAAGAGAGACATCTAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014937.2-989s1c1
Sequence:CCGGCGATTTCTAGTGGCTCTCATTCTCGAGAATGAGAGCCACTAGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014937.2-3258s1c1
Sequence:CCGGCGCATTCAGTTGCATCTCAAACTCGAGTTTGAGATGCAACTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014937.2-481s1c1
Sequence:CCGGGCTCTGTAAGAAGCATCATTTCTCGAGAAATGATGCTTCTTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014937.2-2120s1c1
Sequence:CCGGGCCTATTATGATGATGAAGTTCTCGAGAACTTCATCATCATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014937
VALIDATED
INPP5F MISSION shRNA shRNA Plasmid DNA
inositol polyphosphate-5-phosphatase F
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014937.2-2120s21c1
Sequence:CCGGGCCTATTATGATGATGAAGTTCTCGAGAACTTCATCATCATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014937.2-3201s21c1
Sequence:CCGGCGCAATTAGATGTCTCTCTTTCTCGAGAAAGAGAGACATCTAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014937.2-3696s21c1
Sequence:CCGGAGTCGGAACCTGAGTAGATTTCTCGAGAAATCTACTCAGGTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014937.2-989s21c1
Sequence:CCGGCGATTTCTAGTGGCTCTCATTCTCGAGAATGAGAGCCACTAGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014937.2-481s21c1
Sequence:CCGGGCTCTGTAAGAAGCATCATTTCTCGAGAAATGATGCTTCTTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014937.2-3822s21c1
Sequence:GTACCGGACAGGTCACTTTGGGATATAACTCGAGTTATATCCCAAAGTGACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014937.2-3201s1c1
Sequence:CCGGCGCAATTAGATGTCTCTCTTTCTCGAGAAAGAGAGACATCTAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014937.2-989s1c1
Sequence:CCGGCGATTTCTAGTGGCTCTCATTCTCGAGAATGAGAGCCACTAGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014937.2-3258s1c1
Sequence:CCGGCGCATTCAGTTGCATCTCAAACTCGAGTTTGAGATGCAACTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014937.2-481s1c1
Sequence:CCGGGCTCTGTAAGAAGCATCATTTCTCGAGAAATGATGCTTCTTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014937.2-2120s1c1
Sequence:CCGGGCCTATTATGATGATGAAGTTCTCGAGAACTTCATCATCATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014937
VALIDATED
INPP5F MISSION shRNA Lentiviral Transduction Particles
inositol polyphosphate-5-phosphatase F
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014937.2-2120s21c1
Sequence:CCGGGCCTATTATGATGATGAAGTTCTCGAGAACTTCATCATCATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014937.2-3201s21c1
Sequence:CCGGCGCAATTAGATGTCTCTCTTTCTCGAGAAAGAGAGACATCTAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014937.2-3696s21c1
Sequence:CCGGAGTCGGAACCTGAGTAGATTTCTCGAGAAATCTACTCAGGTTCCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_014937.2-989s21c1
Sequence:CCGGCGATTTCTAGTGGCTCTCATTCTCGAGAATGAGAGCCACTAGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014937.2-481s21c1
Sequence:CCGGGCTCTGTAAGAAGCATCATTTCTCGAGAAATGATGCTTCTTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380377    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014937.2-3822s21c1
Sequence:GTACCGGACAGGTCACTTTGGGATATAACTCGAGTTATATCCCAAAGTGACCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014937.2-3201s1c1
Sequence:CCGGCGCAATTAGATGTCTCTCTTTCTCGAGAAAGAGAGACATCTAATTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014937.2-989s1c1
Sequence:CCGGCGATTTCTAGTGGCTCTCATTCTCGAGAATGAGAGCCACTAGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014937.2-3258s1c1
Sequence:CCGGCGCATTCAGTTGCATCTCAAACTCGAGTTTGAGATGCAACTGAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_014937.2-481s1c1
Sequence:CCGGGCTCTGTAAGAAGCATCATTTCTCGAGAAATGATGCTTCTTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014937.2-2120s1c1
Sequence:CCGGGCCTATTATGATGATGAAGTTCTCGAGAACTTCATCATCATAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks