EMAIL THIS PAGE TO A FRIEND

INS-IGF2

INS-IGF2 readthrough

Synonyms: INSIGF
Species: Human INS-IGF2(723961)
UniProtKB ID: F8WCM5, Q1WM24
Gene ID:
Human(723961) Summary: This locus includes two alternatively spliced read-through transcript variants which align to the INS gene in the 5' region and to the IGF2 gene in the 3' region. One transcript is predicted to encode a protein which shares the N-terminus with the INS protein but has a distinct and longer C-terminus, whereas the other transcript is a candidate for nonsense-mediated decay (NMD). The transcripts are imprinted and are paternally expressed in the limb and eye. [provided by RefSeq, Jul 2008]
30 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412977 Anti-INS-IGF2 antibody produced in mouse purified immunoglobulin, 1 mg/mL human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001042376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042376 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042376 Rosetta Predictions human pricing
NR_003512 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309358 predicted 312
2 SASI_Hs02_00309359 predicted 320
3 SASI_Hs02_00309360 predicted 320
4 SASI_Hs02_00309361 predicted 278
5 SASI_Hs02_00309362 predicted 321
6 SASI_Hs02_00309363 predicted 315
7 SASI_Hs02_00309364 predicted 228
8 SASI_Hs02_00309365 predicted 249
9 SASI_Hs02_00309366 predicted 211
10 SASI_Hs02_00309367 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379387 predicted 4649
2 SASI_Hs02_00379388 predicted 3190
3 SASI_Hs02_00379389 predicted 4853
4 SASI_Hs02_00379390 predicted 4624
5 SASI_Hs02_00379391 predicted 4306
6 SASI_Hs02_00379392 predicted 4595
7 SASI_Hs02_00379393 predicted 3092
8 SASI_Hs02_00379394 predicted 4619
9 SASI_Hs02_00379395 predicted 3058
10 SASI_Hs02_00379396 predicted 4628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042376
INS-IGF2 MISSION shRNA Bacterial Glycerol Stock
INS-IGF2 readthrough
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-190s21c1
Sequence:CCGGGGGAACGAGGCTTCTTCTACACTCGAGTGTAGAAGAAGCCTCGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-408s21c1
Sequence:CCGGCCGGTCCTCTTTATCCACTGTCTCGAGACAGTGGATAAAGAGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-165s21c1
Sequence:CCGGGTGGAAGCTCTCTACCTAGTGCTCGAGCACTAGGTAGAGAGCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-325s21c1
Sequence:CCGGTGGTGGTGACTGCTAATATTGCTCGAGCAATATTAGCAGTCACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-358s21c1
Sequence:CCGGGATCATCGTCCAGGCAGTTTCCTCGAGGAAACTGCCTGGACGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042376
INS-IGF2 MISSION shRNA shRNA Plasmid DNA
INS-IGF2 readthrough
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-190s21c1
Sequence:CCGGGGGAACGAGGCTTCTTCTACACTCGAGTGTAGAAGAAGCCTCGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-408s21c1
Sequence:CCGGCCGGTCCTCTTTATCCACTGTCTCGAGACAGTGGATAAAGAGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-165s21c1
Sequence:CCGGGTGGAAGCTCTCTACCTAGTGCTCGAGCACTAGGTAGAGAGCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-325s21c1
Sequence:CCGGTGGTGGTGACTGCTAATATTGCTCGAGCAATATTAGCAGTCACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-358s21c1
Sequence:CCGGGATCATCGTCCAGGCAGTTTCCTCGAGGAAACTGCCTGGACGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042376
INS-IGF2 MISSION shRNA Lentiviral Transduction Particles
INS-IGF2 readthrough
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-190s21c1
Sequence:CCGGGGGAACGAGGCTTCTTCTACACTCGAGTGTAGAAGAAGCCTCGTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-408s21c1
Sequence:CCGGCCGGTCCTCTTTATCCACTGTCTCGAGACAGTGGATAAAGAGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-165s21c1
Sequence:CCGGGTGGAAGCTCTCTACCTAGTGCTCGAGCACTAGGTAGAGAGCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-325s21c1
Sequence:CCGGTGGTGGTGACTGCTAATATTGCTCGAGCAATATTAGCAGTCACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042376.1-358s21c1
Sequence:CCGGGATCATCGTCCAGGCAGTTTCCTCGAGGAAACTGCCTGGACGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks