EMAIL THIS PAGE TO A FRIEND

INS

insulin

Synonyms: IDDM2 ILPR IRDN MODY10
UniProtKB ID: P01308, Q5EEX2
Gene ID:
Human(3630) Summary: After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake. A multitude of mutant alleles with phenotypic effects have been identified. There is a read-through gene, INS-IGF2, which overlaps with this gene at the 5' region and with the IGF2 gene at the 3' region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
Zebrafish(30262) preproinsulin
chicken(100327578) Insulin level
chicken(100327340) Insulin level
chicken(396145) insulin
chicken(100310645) Insulin level
chicken(100327337) Insulin level
chicken(100309524) Insulin level
cow(280829) insulin
dog(483665) insulin
chicken(100327333) Insulin level
chicken(100327347) Insulin level
chicken(100327350) Insulin level
chicken(100327579) Insulin level
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
I1633 Insulin chain A oxidized ammonium salt from bovine pancreas ≥80% (HPLC), powder cow pricing
I6383 Insulin Chain B Oxidized from bovine pancreas ≥80% (HPLC), powder cow pricing
I1764 Insulin Chain B Oxidized from bovine pancreas BioReagent, suitable for sequencing cow pricing
I5500 Insulin from bovine pancreas ≥25 USP units/mg (HPLC), powder cow pricing
I6634 Insulin from bovine pancreas powder, BioReagent, suitable for cell culture cow pricing
I8405 Insulin from bovine pancreas meets USP testing specifications cow pricing
C8662 C-Peptide Fragment 3-33 human ≥85% (HPLC) human pricing
C5051 C-Peptide human ≥95% (HPLC) human pricing
I1507 Insulin human ≥95% (HPLC), semisynthetic, powder human pricing
I2643 Insulin human recombinant, expressed in yeast (proprietary host) human pricing
APREST85926 PrEST Antigen INS Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
C9781 Tyr-C-Peptide human ≥95% (HPLC) human pricing
I4011 Insulin from bovine pancreas Hybri-Max, powder, suitable for hybridoma pricing
I2767 Insulin sodium salt human recombinant, expressed in E. coli, crystalline, cell culture tested pricing
I0516 Insulin solution from bovine pancreas 10 mg/mL insulin in 25  mM HEPES, pH 8.2, BioReagent, sterile-filtered, suitable for cell culture pricing
I9278 Insulin solution human Chemically defined, recombinant from Saccharomyces cerevisiae, sterile-filtered, BioXtra, suitable for cell culture pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000207 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000207 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175219 predicted 415
2 SASI_Hs02_00302085 predicted 424
3 SASI_Hs02_00302086 predicted 425
4 SASI_Hs01_00175221 predicted 366
5 SASI_Hs02_00302087 predicted 435
6 SASI_Hs02_00302088 predicted 432
7 SASI_Hs01_00175216 predicted 319
8 SASI_Hs01_00175217 predicted 429
9 SASI_Hs01_00175218 predicted 191
10 SASI_Hs02_00302089 predicted 306
11 SASI_Hs01_00175220 predicted 139
12 SASI_Hs01_00175222 predicted 310
13 SASI_Hs01_00175223 predicted 114
14 SASI_Hs01_00175224 predicted 326
15 SASI_Hs01_00175225 predicted 108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000207
INS MISSION shRNA Bacterial Glycerol Stock
insulin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000207.2-167s21c1
Sequence:CCGGGGAAGCTCTCTACCTAGTGTGCTCGAGCACACTAGGTAGAGAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000207.2-322s21c1
Sequence:CCGGAGCGTGGCATTGTGGAACAATCTCGAGATTGTTCCACAATGCCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-299s1c1
Sequence:CCGGCCTGCAGAAGCGTGGCATTGTCTCGAGACAATGCCACGCTTCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-135s1c1
Sequence:CCGGTGCGGCTCACACCTGGTGGAACTCGAGTTCCACCAGGTGTGAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-182s1c1
Sequence:CCGGAGGCTTCTTCTACACACCCAACTCGAGTTGGGTGTGTAGAAGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-115s1c1
Sequence:CCGGCCTTTGTGAACCAACACCTGTCTCGAGACAGGTGTTGGTTCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-108s1c1
Sequence:CCGGGCCGCAGCCTTTGTGAACCAACTCGAGTTGGTTCACAAAGGCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000207
INS MISSION shRNA shRNA Plasmid DNA
insulin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000207.2-167s21c1
Sequence:CCGGGGAAGCTCTCTACCTAGTGTGCTCGAGCACACTAGGTAGAGAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000207.2-322s21c1
Sequence:CCGGAGCGTGGCATTGTGGAACAATCTCGAGATTGTTCCACAATGCCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-299s1c1
Sequence:CCGGCCTGCAGAAGCGTGGCATTGTCTCGAGACAATGCCACGCTTCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-135s1c1
Sequence:CCGGTGCGGCTCACACCTGGTGGAACTCGAGTTCCACCAGGTGTGAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-182s1c1
Sequence:CCGGAGGCTTCTTCTACACACCCAACTCGAGTTGGGTGTGTAGAAGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-115s1c1
Sequence:CCGGCCTTTGTGAACCAACACCTGTCTCGAGACAGGTGTTGGTTCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-108s1c1
Sequence:CCGGGCCGCAGCCTTTGTGAACCAACTCGAGTTGGTTCACAAAGGCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000207
INS MISSION shRNA Lentiviral Transduction Particles
insulin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000207.2-167s21c1
Sequence:CCGGGGAAGCTCTCTACCTAGTGTGCTCGAGCACACTAGGTAGAGAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000207.2-322s21c1
Sequence:CCGGAGCGTGGCATTGTGGAACAATCTCGAGATTGTTCCACAATGCCACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-299s1c1
Sequence:CCGGCCTGCAGAAGCGTGGCATTGTCTCGAGACAATGCCACGCTTCTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-135s1c1
Sequence:CCGGTGCGGCTCACACCTGGTGGAACTCGAGTTCCACCAGGTGTGAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-182s1c1
Sequence:CCGGAGGCTTCTTCTACACACCCAACTCGAGTTGGGTGTGTAGAAGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-115s1c1
Sequence:CCGGCCTTTGTGAACCAACACCTGTCTCGAGACAGGTGTTGGTTCACAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000207.1-108s1c1
Sequence:CCGGGCCGCAGCCTTTGTGAACCAACTCGAGTTGGTTCACAAAGGCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks