EMAIL THIS PAGE TO A FRIEND

INSC

inscuteable homolog (Drosophila)

Gene ID:
Human(387755) Summary: In Drosophila, neuroblasts divide asymmetrically into another neuroblast at the apical side and a smaller ganglion mother cell on the basal side. Cell polarization is precisely regulated by 2 apically localized multiprotein signaling complexes that are tethered by Inscuteable, which regulates their apical localization (Izaki et al., 2006 [PubMed 16458856]
Mouse(233752) inscuteable homolog (Drosophila)
Rat(293166) inscuteable homolog (Drosophila)
fruit fly(37355) inscuteable
dog(611775) inscuteable homolog (Drosophila)
Horse(100056304) inscuteable homolog (Drosophila)
cow(784497) inscuteable homolog (Drosophila)
domestic cat(101094950) inscuteable homolog (Drosophila)
chicken(423067) inscuteable homolog (Drosophila)
sheep(101116598) inscuteable homolog (Drosophila)
Domestic Rabbit(100354088) inscuteable homolog (Drosophila)
domestic guinea pig(100731818) inscuteable homolog (Drosophila)
naked mole-rat(101726777) inscuteable homolog (Drosophila)
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031853 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031853 Rosetta Predictions human pricing
NM_001042536 Rosetta Predictions human pricing
NM_001106285 Rosetta Predictions rat pricing
NM_173767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307848 predicted 1266
2 SASI_Hs01_00062857 predicted 1423
3 SASI_Hs02_00307849 predicted 521
4 SASI_Hs01_00062859 predicted 1839
5 SASI_Hs02_00307850 predicted 1336
6 SASI_Hs02_00307851 predicted 663
7 SASI_Hs02_00307852 predicted 1390
8 SASI_Hs02_00307853 predicted 898
9 SASI_Hs02_00307854 predicted 1512
10 SASI_Hs02_00307855 predicted 1005
11 SASI_Hs01_00062855 predicted 916
12 SASI_Hs01_00062856 predicted 1801
13 SASI_Hs01_00062858 predicted 1880
14 SASI_Hs01_00062860 predicted 1843
15 SASI_Hs01_00062861 predicted 584
16 SASI_Hs01_00062862 predicted 1835
17 SASI_Hs01_00062863 predicted 1239
18 SASI_Hs01_00062864 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310428 predicted 1191
2 SASI_Hs02_00310429 predicted 1355
3 SASI_Hs02_00310430 predicted 448
4 SASI_Hs02_00310431 predicted 1758
5 SASI_Hs02_00310432 predicted 1257
6 SASI_Hs02_00310433 predicted 584
7 SASI_Hs02_00310434 predicted 1315
8 SASI_Hs02_00310435 predicted 821
9 SASI_Hs02_00310436 predicted 1435
10 SASI_Hs02_00310437 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217468 predicted 771
2 SASI_Rn02_00217469 predicted 1693
3 SASI_Rn02_00217470 predicted 1450
4 SASI_Rn02_00217471 predicted 1429
5 SASI_Rn02_00217472 predicted 1350
6 SASI_Rn02_00217473 predicted 645
7 SASI_Rn02_00217474 predicted 293
8 SASI_Rn02_00217475 predicted 276
9 SASI_Rn02_00217476 predicted 408
10 SASI_Rn02_00217477 predicted 1446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100758 predicted 755
2 SASI_Mm01_00100759 predicted 1527
3 SASI_Mm01_00100760 predicted 1836
4 SASI_Mm01_00100761 predicted 1125
5 SASI_Mm01_00100762 predicted 1327
6 SASI_Mm01_00100763 predicted 1113
7 SASI_Mm02_00345422 predicted 389
8 SASI_Mm01_00100765 predicted 1839
9 SASI_Mm01_00100766 predicted 1197
10 SASI_Mm01_00100767 predicted 1872
11 SASI_Mm01_00100764 predicted 917
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031853
INSC MISSION shRNA Bacterial Glycerol Stock
inscuteable homolog (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-454s1c1
Sequence:CCGGGAAGGAAATGGGCGAGATTGACTCGAGTCAATCTCGCCCATTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-466s1c1
Sequence:CCGGCGAGATTGAGAAGCTGCTAATCTCGAGATTAGCAGCTTCTCAATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-1386s1c1
Sequence:CCGGCCTCTGACATCATTCAGGAAACTCGAGTTTCCTGAATGATGTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031853.2-160s1c1
Sequence:CCGGGATGGAAGATCTGAAGCTCATCTCGAGATGAGCTTCAGATCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031853.2-1342s1c1
Sequence:CCGGGATTGTGACCATCTTGGCAAACTCGAGTTTGCCAAGATGGTCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-1230s1c1
Sequence:CCGGCGTTCTTTGACACAATGGCCTCTCGAGAGGCCATTGTGTCAAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-1265s1c1
Sequence:CCGGCAGTTGAATGCCATCCGTGTTCTCGAGAACACGGATGGCATTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031853.2-1253s1c1
Sequence:CCGGGAGATGCTCCTGCAGTTGAATCTCGAGATTCAACTGCAGGAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031853.3-2712s1c1
Sequence:CCGGTGGCCATAGTGGGAGTATTTACTCGAGTAAATACTCCCACTATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000220002    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031853.3-2529s1c1
Sequence:CCGGATCCTCAGATGAGGCTTATTGCTCGAGCAATAAGCCTCATCTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031853
INSC MISSION shRNA shRNA Plasmid DNA
inscuteable homolog (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-454s1c1
Sequence:CCGGGAAGGAAATGGGCGAGATTGACTCGAGTCAATCTCGCCCATTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-466s1c1
Sequence:CCGGCGAGATTGAGAAGCTGCTAATCTCGAGATTAGCAGCTTCTCAATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-1386s1c1
Sequence:CCGGCCTCTGACATCATTCAGGAAACTCGAGTTTCCTGAATGATGTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031853.2-160s1c1
Sequence:CCGGGATGGAAGATCTGAAGCTCATCTCGAGATGAGCTTCAGATCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031853.2-1342s1c1
Sequence:CCGGGATTGTGACCATCTTGGCAAACTCGAGTTTGCCAAGATGGTCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-1230s1c1
Sequence:CCGGCGTTCTTTGACACAATGGCCTCTCGAGAGGCCATTGTGTCAAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-1265s1c1
Sequence:CCGGCAGTTGAATGCCATCCGTGTTCTCGAGAACACGGATGGCATTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031853.2-1253s1c1
Sequence:CCGGGAGATGCTCCTGCAGTTGAATCTCGAGATTCAACTGCAGGAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031853.3-2712s1c1
Sequence:CCGGTGGCCATAGTGGGAGTATTTACTCGAGTAAATACTCCCACTATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000220002    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031853.3-2529s1c1
Sequence:CCGGATCCTCAGATGAGGCTTATTGCTCGAGCAATAAGCCTCATCTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031853
INSC MISSION shRNA Lentiviral Transduction Particles
inscuteable homolog (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-454s1c1
Sequence:CCGGGAAGGAAATGGGCGAGATTGACTCGAGTCAATCTCGCCCATTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-466s1c1
Sequence:CCGGCGAGATTGAGAAGCTGCTAATCTCGAGATTAGCAGCTTCTCAATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-1386s1c1
Sequence:CCGGCCTCTGACATCATTCAGGAAACTCGAGTTTCCTGAATGATGTCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031853.2-160s1c1
Sequence:CCGGGATGGAAGATCTGAAGCTCATCTCGAGATGAGCTTCAGATCTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137242    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031853.2-1342s1c1
Sequence:CCGGGATTGTGACCATCTTGGCAAACTCGAGTTTGCCAAGATGGTCACAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-1230s1c1
Sequence:CCGGCGTTCTTTGACACAATGGCCTCTCGAGAGGCCATTGTGTCAAAGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001031853.2-1265s1c1
Sequence:CCGGCAGTTGAATGCCATCCGTGTTCTCGAGAACACGGATGGCATTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138788    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031853.2-1253s1c1
Sequence:CCGGGAGATGCTCCTGCAGTTGAATCTCGAGATTCAACTGCAGGAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220003    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031853.3-2712s1c1
Sequence:CCGGTGGCCATAGTGGGAGTATTTACTCGAGTAAATACTCCCACTATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000220002    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031853.3-2529s1c1
Sequence:CCGGATCCTCAGATGAGGCTTATTGCTCGAGCAATAAGCCTCATCTGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173767
INSC MISSION shRNA Bacterial Glycerol Stock
inscuteable homolog (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173767.3-1678s21c1
Sequence:CCGGGCTGTATGTCTCGCCTGATTGCTCGAGCAATCAGGCGAGACATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173767.3-762s21c1
Sequence:CCGGGAGCATGTTCTGAAGTCAATGCTCGAGCATTGACTTCAGAACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173767.3-882s21c1
Sequence:CCGGATCGATACCTCAGACAATATCCTCGAGGATATTGTCTGAGGTATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173767.3-1847s21c1
Sequence:CCGGCTTCTTACTGTGTAGCAATATCTCGAGATATTGCTACACAGTAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173767.3-2115s21c1
Sequence:CCGGCCTCTCTTCTCAGCATATATTCTCGAGAATATATGCTGAGAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173767
INSC MISSION shRNA shRNA Plasmid DNA
inscuteable homolog (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173767.3-1678s21c1
Sequence:CCGGGCTGTATGTCTCGCCTGATTGCTCGAGCAATCAGGCGAGACATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173767.3-762s21c1
Sequence:CCGGGAGCATGTTCTGAAGTCAATGCTCGAGCATTGACTTCAGAACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173767.3-882s21c1
Sequence:CCGGATCGATACCTCAGACAATATCCTCGAGGATATTGTCTGAGGTATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173767.3-1847s21c1
Sequence:CCGGCTTCTTACTGTGTAGCAATATCTCGAGATATTGCTACACAGTAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173767.3-2115s21c1
Sequence:CCGGCCTCTCTTCTCAGCATATATTCTCGAGAATATATGCTGAGAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173767
INSC MISSION shRNA Lentiviral Transduction Particles
inscuteable homolog (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173767.3-1678s21c1
Sequence:CCGGGCTGTATGTCTCGCCTGATTGCTCGAGCAATCAGGCGAGACATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173767.3-762s21c1
Sequence:CCGGGAGCATGTTCTGAAGTCAATGCTCGAGCATTGACTTCAGAACATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173767.3-882s21c1
Sequence:CCGGATCGATACCTCAGACAATATCCTCGAGGATATTGTCTGAGGTATCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173767.3-1847s21c1
Sequence:CCGGCTTCTTACTGTGTAGCAATATCTCGAGATATTGCTACACAGTAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173767.3-2115s21c1
Sequence:CCGGCCTCTCTTCTCAGCATATATTCTCGAGAATATATGCTGAGAAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks