EMAIL THIS PAGE TO A FRIEND

INSL5

insulin-like 5

Synonyms: PRO182 UNQ156
UniProtKB ID: Q9Y5Q6, Q3MIY4, Q5VYD8
Gene ID:
Human(10022) Summary: The protein encoded by this gene contains a classical signature of the insulin superfamily and is highly similar to relaxin 3 (RLN3/INSL7). [provided by RefSeq, Jul 2008]
Mouse(23919) insulin-like 5
cow(613480) insulin-like 5
sheep(101113287) insulin-like 5
naked mole-rat(101702142) insulin-like 5
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005478 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005478 Rosetta Predictions human pricing
NM_011831 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119517 predicted 402
2 SASI_Hs01_00119518 predicted 326
3 SASI_Hs01_00119519 predicted 468
4 SASI_Hs01_00119521 predicted 450
5 SASI_Hs01_00119522 predicted 385
6 SASI_Hs01_00119523 predicted 448
7 SASI_Hs01_00119525 predicted 426
8 SASI_Hs01_00119526 predicted 404
9 SASI_Hs02_00339657 predicted 475
10 SASI_Hs02_00339658 predicted 355
11 SASI_Hs01_00119520 predicted 369
12 SASI_Hs01_00119524 predicted 379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011831 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048043 predicted 368
2 SASI_Mm01_00048044 predicted 194
3 SASI_Mm02_00321547 predicted 198
4 SASI_Mm01_00048045 predicted 294
5 SASI_Mm01_00048046 predicted 361
6 SASI_Mm01_00048047 predicted 359
7 SASI_Mm01_00048048 predicted 275
8 SASI_Mm01_00048049 predicted 357
9 SASI_Mm02_00321548 predicted 298
10 SASI_Mm01_00048051 predicted 363
11 SASI_Mm01_00048050 predicted 468
12 SASI_Mm01_00048052 predicted 391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005478
INSL5 MISSION shRNA Bacterial Glycerol Stock
insulin-like 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005478.3-429s21c1
Sequence:CCGGAGTGCTCTTTGCTAAGACAAGCTCGAGCTTGTCTTAGCAAAGAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005478.3-506s21c1
Sequence:CCGGTGCCTGGTAGAACACTAATATCTCGAGATATTAGTGTTCTACCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005478.3-334s1c1
Sequence:CCGGCTGAAGAGCTTTGGAAGTCAACTCGAGTTGACTTCCAAAGCTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005478.3-350s1c1
Sequence:CCGGGTCAAAGAAGCATTCAGTGATCTCGAGATCACTGAATGCTTCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005478.3-360s1c1
Sequence:CCGGCATTCAGTGATGTCAAGACAACTCGAGTTGTCTTGACATCACTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005478.3-469s1c1
Sequence:CCGGGCAGAGCTTTATCACATGTTTCTCGAGAAACATGTGATAAAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005478.3-134s1c1
Sequence:CCGGCATACGGACAGTCATCTATATCTCGAGATATAGATGACTGTCCGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005478.3-387s1c1
Sequence:CCGGCAAACTTTGTGTTGCACTGATCTCGAGATCAGTGCAACACAAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005478.3-234s1c1
Sequence:CCGGCTCCCACATAAACGTGAGTTTCTCGAGAAACTCACGTTTATGTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005478
INSL5 MISSION shRNA shRNA Plasmid DNA
insulin-like 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005478.3-429s21c1
Sequence:CCGGAGTGCTCTTTGCTAAGACAAGCTCGAGCTTGTCTTAGCAAAGAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005478.3-506s21c1
Sequence:CCGGTGCCTGGTAGAACACTAATATCTCGAGATATTAGTGTTCTACCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005478.3-334s1c1
Sequence:CCGGCTGAAGAGCTTTGGAAGTCAACTCGAGTTGACTTCCAAAGCTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005478.3-350s1c1
Sequence:CCGGGTCAAAGAAGCATTCAGTGATCTCGAGATCACTGAATGCTTCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005478.3-360s1c1
Sequence:CCGGCATTCAGTGATGTCAAGACAACTCGAGTTGTCTTGACATCACTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005478.3-469s1c1
Sequence:CCGGGCAGAGCTTTATCACATGTTTCTCGAGAAACATGTGATAAAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005478.3-134s1c1
Sequence:CCGGCATACGGACAGTCATCTATATCTCGAGATATAGATGACTGTCCGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005478.3-387s1c1
Sequence:CCGGCAAACTTTGTGTTGCACTGATCTCGAGATCAGTGCAACACAAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005478.3-234s1c1
Sequence:CCGGCTCCCACATAAACGTGAGTTTCTCGAGAAACTCACGTTTATGTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005478
INSL5 MISSION shRNA Lentiviral Transduction Particles
insulin-like 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005478.3-429s21c1
Sequence:CCGGAGTGCTCTTTGCTAAGACAAGCTCGAGCTTGTCTTAGCAAAGAGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005478.3-506s21c1
Sequence:CCGGTGCCTGGTAGAACACTAATATCTCGAGATATTAGTGTTCTACCAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005478.3-334s1c1
Sequence:CCGGCTGAAGAGCTTTGGAAGTCAACTCGAGTTGACTTCCAAAGCTCTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005478.3-350s1c1
Sequence:CCGGGTCAAAGAAGCATTCAGTGATCTCGAGATCACTGAATGCTTCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005478.3-360s1c1
Sequence:CCGGCATTCAGTGATGTCAAGACAACTCGAGTTGTCTTGACATCACTGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151601    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005478.3-469s1c1
Sequence:CCGGGCAGAGCTTTATCACATGTTTCTCGAGAAACATGTGATAAAGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005478.3-134s1c1
Sequence:CCGGCATACGGACAGTCATCTATATCTCGAGATATAGATGACTGTCCGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005478.3-387s1c1
Sequence:CCGGCAAACTTTGTGTTGCACTGATCTCGAGATCAGTGCAACACAAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005478.3-234s1c1
Sequence:CCGGCTCCCACATAAACGTGAGTTTCTCGAGAAACTCACGTTTATGTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011831
INSL5 MISSION shRNA Bacterial Glycerol Stock
insulin-like 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011831.1-196s1c1
Sequence:CCGGCATTTCCACTCTCAACAAGCTCTCGAGAGCTTGTTGAGAGTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011831.1-545s1c1
Sequence:CCGGCCTTTCCTTAAAGGTCTATTACTCGAGTAATAGACCTTTAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011831.1-138s1c1
Sequence:CCGGCGTGAGAACAGTTATCTACATCTCGAGATGTAGATAACTGTTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011831.1-146s1c1
Sequence:CCGGCAGTTATCTACATCTGTGCCACTCGAGTGGCACAGATGTAGATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011831.1-130s1c1
Sequence:CCGGCTGGACTACGTGAGAACAGTTCTCGAGAACTGTTCTCACGTAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011831
INSL5 MISSION shRNA shRNA Plasmid DNA
insulin-like 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011831.1-196s1c1
Sequence:CCGGCATTTCCACTCTCAACAAGCTCTCGAGAGCTTGTTGAGAGTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011831.1-545s1c1
Sequence:CCGGCCTTTCCTTAAAGGTCTATTACTCGAGTAATAGACCTTTAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011831.1-138s1c1
Sequence:CCGGCGTGAGAACAGTTATCTACATCTCGAGATGTAGATAACTGTTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011831.1-146s1c1
Sequence:CCGGCAGTTATCTACATCTGTGCCACTCGAGTGGCACAGATGTAGATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011831.1-130s1c1
Sequence:CCGGCTGGACTACGTGAGAACAGTTCTCGAGAACTGTTCTCACGTAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011831
INSL5 MISSION shRNA Lentiviral Transduction Particles
insulin-like 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011831.1-196s1c1
Sequence:CCGGCATTTCCACTCTCAACAAGCTCTCGAGAGCTTGTTGAGAGTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176770    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011831.1-545s1c1
Sequence:CCGGCCTTTCCTTAAAGGTCTATTACTCGAGTAATAGACCTTTAAGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011831.1-138s1c1
Sequence:CCGGCGTGAGAACAGTTATCTACATCTCGAGATGTAGATAACTGTTCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011831.1-146s1c1
Sequence:CCGGCAGTTATCTACATCTGTGCCACTCGAGTGGCACAGATGTAGATAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200187    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011831.1-130s1c1
Sequence:CCGGCTGGACTACGTGAGAACAGTTCTCGAGAACTGTTCTCACGTAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks