EMAIL THIS PAGE TO A FRIEND

INTS4

integrator complex subunit 4

Synonyms: INT4 MST093
Gene ID:
Human(92105) Summary: INTS4 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]
Mouse(101861) integrator complex subunit 4
Rat(308837) integrator complex subunit 4
domestic guinea pig(100712822) integrator complex subunit 4
naked mole-rat(101725797) integrator complex subunit 4
sheep(101110460) integrator complex subunit 4
fruit fly(31793) Integrator 4
dog(476795) integrator complex subunit 4
Horse(100051369) integrator complex subunit 4
cow(505657) integrator complex subunit 4
domestic cat(101080997) integrator complex subunit 4
chicken(419028) integrator complex subunit 4
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033547 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033547 Rosetta Predictions human pricing
XM_218937 Rosetta Predictions rat pricing
XR_008152 Rosetta Predictions rat pricing
NM_027256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097399 predicted 1301
2 SASI_Hs02_00361421 predicted 1705
3 SASI_Hs02_00361422 predicted 1871
4 SASI_Hs01_00097402 predicted 1429
5 SASI_Hs01_00097403 predicted 2220
6 SASI_Hs02_00361423 predicted 673
7 SASI_Hs02_00361424 predicted 2005
8 SASI_Hs01_00097404 predicted 452
9 SASI_Hs01_00097406 predicted 2606
10 SASI_Hs01_00097407 predicted 1641
11 SASI_Hs01_00097398 predicted 860
12 SASI_Hs01_00097400 predicted 2521
13 SASI_Hs01_00097401 predicted 536
14 SASI_Hs01_00097405 predicted 1256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218937 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378187 predicted 1448
2 SASI_Rn02_00378188 predicted 586
3 SASI_Rn02_00378189 predicted 447
4 SASI_Rn02_00378190 predicted 2068
5 SASI_Rn02_00378191 predicted 390
6 SASI_Rn02_00378192 predicted 727
7 SASI_Rn02_00378193 predicted 399
8 SASI_Rn02_00378194 predicted 406
9 SASI_Rn02_00378195 predicted 2058
10 SASI_Rn02_00378196 predicted 1566
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152619 predicted 1472
2 SASI_Rn01_00152620 predicted 571
3 SASI_Rn01_00152621 predicted 430
4 SASI_Rn01_00152622 predicted 2099
5 SASI_Rn01_00152623 predicted 364
6 SASI_Rn01_00152624 predicted 708
7 SASI_Rn01_00152625 predicted 3112
8 SASI_Rn01_00152627 predicted 386
9 SASI_Rn01_00152628 predicted 2081
10 SASI_Rn02_00416351 predicted 1797
11 SASI_Rn01_00152626 predicted 3129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170783 predicted 597
2 SASI_Mm01_00170784 predicted 1458
3 SASI_Mm01_00170785 predicted 469
4 SASI_Mm01_00170786 predicted 584
5 SASI_Mm01_00170787 predicted 1931
6 SASI_Mm01_00170788 predicted 2075
7 SASI_Mm01_00170789 predicted 2575
8 SASI_Mm01_00170790 predicted 2832
9 SASI_Mm01_00170791 predicted 1189
10 SASI_Mm01_00170792 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033547
VALIDATED
INTS4 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 4
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-2698s21c1
Sequence:CCGGCCGGCTCATCACTCAGGTTTACTCGAGTAAACCTGAGTGATGAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033547.3-3000s21c1
Sequence:CCGGTGGAATTGATGTGTAGGCTTACTCGAGTAAGCCTACACATCAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-461s21c1
Sequence:CCGGCAAGCTATCCAAATGCGATTACTCGAGTAATCGCATTTGGATAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-410s21c1
Sequence:CCGGGCTCAACTGCTGGATACTTTGCTCGAGCAAAGTATCCAGCAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-658s21c1
Sequence:CCGGTGTCAGAACAGCAGCTATAAACTCGAGTTTATAGCTGCTGTTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-100s21c1
Sequence:CCGGTACTAAGAAACTCCGACTAACCTCGAGGTTAGTCGGAGTTTCTTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033547.3-2958s21c1
Sequence:CCGGCTTCTTAGGTGTCAGAATGAGCTCGAGCTCATTCTGACACCTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033547.2-584s1c1
Sequence:CCGGGCTCCATGAAAGAGGACTGAACTCGAGTTCAGTCCTCTTTCATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033547.2-1592s1c1
Sequence:CCGGCTGTCCAACAATGCCAGCATTCTCGAGAATGCTGGCATTGTTGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_033547.2-393s1c1
Sequence:CCGGCATCTGACAGATACGTCTCATCTCGAGATGAGACGTATCTGTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_033547.2-753s1c1
Sequence:CCGGCGCTTAGTTGATGATGCGTTTCTCGAGAAACGCATCATCAACTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033547.2-630s1c1
Sequence:CCGGGCCTGTAAATTACTCTCTGATCTCGAGATCAGAGAGTAATTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033547.2-1524s1c1
Sequence:CCGGGCTGAACCAGACATGGATGATCTCGAGATCATCCATGTCTGGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033547.2-851s1c1
Sequence:CCGGGCAAGTCAGTTCTCATTTCTTCTCGAGAAGAAATGAGAACTGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033547
VALIDATED
INTS4 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 4
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-2698s21c1
Sequence:CCGGCCGGCTCATCACTCAGGTTTACTCGAGTAAACCTGAGTGATGAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033547.3-3000s21c1
Sequence:CCGGTGGAATTGATGTGTAGGCTTACTCGAGTAAGCCTACACATCAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-461s21c1
Sequence:CCGGCAAGCTATCCAAATGCGATTACTCGAGTAATCGCATTTGGATAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-410s21c1
Sequence:CCGGGCTCAACTGCTGGATACTTTGCTCGAGCAAAGTATCCAGCAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-658s21c1
Sequence:CCGGTGTCAGAACAGCAGCTATAAACTCGAGTTTATAGCTGCTGTTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-100s21c1
Sequence:CCGGTACTAAGAAACTCCGACTAACCTCGAGGTTAGTCGGAGTTTCTTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033547.3-2958s21c1
Sequence:CCGGCTTCTTAGGTGTCAGAATGAGCTCGAGCTCATTCTGACACCTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033547.2-584s1c1
Sequence:CCGGGCTCCATGAAAGAGGACTGAACTCGAGTTCAGTCCTCTTTCATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033547.2-1592s1c1
Sequence:CCGGCTGTCCAACAATGCCAGCATTCTCGAGAATGCTGGCATTGTTGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_033547.2-393s1c1
Sequence:CCGGCATCTGACAGATACGTCTCATCTCGAGATGAGACGTATCTGTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_033547.2-753s1c1
Sequence:CCGGCGCTTAGTTGATGATGCGTTTCTCGAGAAACGCATCATCAACTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033547.2-630s1c1
Sequence:CCGGGCCTGTAAATTACTCTCTGATCTCGAGATCAGAGAGTAATTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033547.2-1524s1c1
Sequence:CCGGGCTGAACCAGACATGGATGATCTCGAGATCATCCATGTCTGGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033547.2-851s1c1
Sequence:CCGGGCAAGTCAGTTCTCATTTCTTCTCGAGAAGAAATGAGAACTGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033547
VALIDATED
INTS4 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 4
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-2698s21c1
Sequence:CCGGCCGGCTCATCACTCAGGTTTACTCGAGTAAACCTGAGTGATGAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414187    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033547.3-3000s21c1
Sequence:CCGGTGGAATTGATGTGTAGGCTTACTCGAGTAAGCCTACACATCAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-461s21c1
Sequence:CCGGCAAGCTATCCAAATGCGATTACTCGAGTAATCGCATTTGGATAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-410s21c1
Sequence:CCGGGCTCAACTGCTGGATACTTTGCTCGAGCAAAGTATCCAGCAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-658s21c1
Sequence:CCGGTGTCAGAACAGCAGCTATAAACTCGAGTTTATAGCTGCTGTTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033547.3-100s21c1
Sequence:CCGGTACTAAGAAACTCCGACTAACCTCGAGGTTAGTCGGAGTTTCTTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033547.3-2958s21c1
Sequence:CCGGCTTCTTAGGTGTCAGAATGAGCTCGAGCTCATTCTGACACCTAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033547.2-584s1c1
Sequence:CCGGGCTCCATGAAAGAGGACTGAACTCGAGTTCAGTCCTCTTTCATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033547.2-1592s1c1
Sequence:CCGGCTGTCCAACAATGCCAGCATTCTCGAGAATGCTGGCATTGTTGGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_033547.2-393s1c1
Sequence:CCGGCATCTGACAGATACGTCTCATCTCGAGATGAGACGTATCTGTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_033547.2-753s1c1
Sequence:CCGGCGCTTAGTTGATGATGCGTTTCTCGAGAAACGCATCATCAACTAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033547.2-630s1c1
Sequence:CCGGGCCTGTAAATTACTCTCTGATCTCGAGATCAGAGAGTAATTTACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033547.2-1524s1c1
Sequence:CCGGGCTGAACCAGACATGGATGATCTCGAGATCATCCATGTCTGGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129887    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033547.2-851s1c1
Sequence:CCGGGCAAGTCAGTTCTCATTTCTTCTCGAGAAGAAATGAGAACTGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027256
VALIDATED
INTS4 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 4
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027256.1-417s1c1
Sequence:CCGGCATAATGGACGACGCCATTAACTCGAGTTAATGGCGTCGTCCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027256.1-880s21c1
Sequence:CCGGCCTGAGAGTATAGTTCCAATACTCGAGTATTGGAACTATACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027256.1-367s21c1
Sequence:CCGGGCATCACTCTTGGGATTATTACTCGAGTAATAATCCCAAGAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027256.1-1326s21c1
Sequence:CCGGCCTTGACTTTCTAGTTGACATCTCGAGATGTCAACTAGAAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027256.1-921s21c1
Sequence:CCGGCCGTCTAGTTGATGATGCATTCTCGAGAATGCATCATCAACTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-174s1c1
Sequence:CCGGCCGATTAACAAAGCCGAGCAACTCGAGTTGCTCGGCTTTGTTAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-2327s1c1
Sequence:CCGGCCTTATTTGGAATGTGTGAAACTCGAGTTTCACACATTCCAAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-1495s1c1
Sequence:CCGGGAACTCTTATGCTGCACTAATCTCGAGATTAGTGCAGCATAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-921s1c1
Sequence:CCGGCCGTCTAGTTGATGATGCATTCTCGAGAATGCATCATCAACTAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_027256.1-2573s1c1
Sequence:CCGGCAGGAGAGTCAGACAATCCTTCTCGAGAAGGATTGTCTGACTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-1506s1c1
Sequence:CCGGCTGCACTAATGTCTCAACCAACTCGAGTTGGTTGAGACATTAGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_027256.1-367s1c1
Sequence:CCGGGCATCACTCTTGGGATTATTACTCGAGTAATAATCCCAAGAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_027256.1-880s1c1
Sequence:CCGGCCTGAGAGTATAGTTCCAATACTCGAGTATTGGAACTATACTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_027256.1-1326s1c1
Sequence:CCGGCCTTGACTTTCTAGTTGACATCTCGAGATGTCAACTAGAAAGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027256
VALIDATED
INTS4 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 4
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027256.1-417s1c1
Sequence:CCGGCATAATGGACGACGCCATTAACTCGAGTTAATGGCGTCGTCCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027256.1-880s21c1
Sequence:CCGGCCTGAGAGTATAGTTCCAATACTCGAGTATTGGAACTATACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027256.1-367s21c1
Sequence:CCGGGCATCACTCTTGGGATTATTACTCGAGTAATAATCCCAAGAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027256.1-1326s21c1
Sequence:CCGGCCTTGACTTTCTAGTTGACATCTCGAGATGTCAACTAGAAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027256.1-921s21c1
Sequence:CCGGCCGTCTAGTTGATGATGCATTCTCGAGAATGCATCATCAACTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-174s1c1
Sequence:CCGGCCGATTAACAAAGCCGAGCAACTCGAGTTGCTCGGCTTTGTTAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-2327s1c1
Sequence:CCGGCCTTATTTGGAATGTGTGAAACTCGAGTTTCACACATTCCAAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-1495s1c1
Sequence:CCGGGAACTCTTATGCTGCACTAATCTCGAGATTAGTGCAGCATAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-921s1c1
Sequence:CCGGCCGTCTAGTTGATGATGCATTCTCGAGAATGCATCATCAACTAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_027256.1-2573s1c1
Sequence:CCGGCAGGAGAGTCAGACAATCCTTCTCGAGAAGGATTGTCTGACTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-1506s1c1
Sequence:CCGGCTGCACTAATGTCTCAACCAACTCGAGTTGGTTGAGACATTAGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_027256.1-367s1c1
Sequence:CCGGGCATCACTCTTGGGATTATTACTCGAGTAATAATCCCAAGAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_027256.1-880s1c1
Sequence:CCGGCCTGAGAGTATAGTTCCAATACTCGAGTATTGGAACTATACTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_027256.1-1326s1c1
Sequence:CCGGCCTTGACTTTCTAGTTGACATCTCGAGATGTCAACTAGAAAGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027256
VALIDATED
INTS4 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 4
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027256.1-417s1c1
Sequence:CCGGCATAATGGACGACGCCATTAACTCGAGTTAATGGCGTCGTCCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027256.1-880s21c1
Sequence:CCGGCCTGAGAGTATAGTTCCAATACTCGAGTATTGGAACTATACTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027256.1-367s21c1
Sequence:CCGGGCATCACTCTTGGGATTATTACTCGAGTAATAATCCCAAGAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027256.1-1326s21c1
Sequence:CCGGCCTTGACTTTCTAGTTGACATCTCGAGATGTCAACTAGAAAGTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027256.1-921s21c1
Sequence:CCGGCCGTCTAGTTGATGATGCATTCTCGAGAATGCATCATCAACTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-174s1c1
Sequence:CCGGCCGATTAACAAAGCCGAGCAACTCGAGTTGCTCGGCTTTGTTAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-2327s1c1
Sequence:CCGGCCTTATTTGGAATGTGTGAAACTCGAGTTTCACACATTCCAAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-1495s1c1
Sequence:CCGGGAACTCTTATGCTGCACTAATCTCGAGATTAGTGCAGCATAAGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-921s1c1
Sequence:CCGGCCGTCTAGTTGATGATGCATTCTCGAGAATGCATCATCAACTAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_027256.1-2573s1c1
Sequence:CCGGCAGGAGAGTCAGACAATCCTTCTCGAGAAGGATTGTCTGACTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_027256.1-1506s1c1
Sequence:CCGGCTGCACTAATGTCTCAACCAACTCGAGTTGGTTGAGACATTAGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_027256.1-367s1c1
Sequence:CCGGGCATCACTCTTGGGATTATTACTCGAGTAATAATCCCAAGAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_027256.1-880s1c1
Sequence:CCGGCCTGAGAGTATAGTTCCAATACTCGAGTATTGGAACTATACTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1.5 Clone ID:NM_027256.1-1326s1c1
Sequence:CCGGCCTTGACTTTCTAGTTGACATCTCGAGATGTCAACTAGAAAGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks