EMAIL THIS PAGE TO A FRIEND

INTS8

integrator complex subunit 8

Synonyms: C8orf52 INT8
Gene ID:
Human(55656) Summary: This gene encodes a subunit of the Integrator complex which is involved in the cleavage of small nuclear RNAs U1 and U2 within the nucleus. The encoded protein associates with RNA polymerase II and is recruited to the U1 and U2 small nuclear RNA genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(72656) integrator complex subunit 8
domestic guinea pig(100733188) integrator complex subunit 8
naked mole-rat(101709159) integrator complex subunit 8
sheep(101109456) integrator complex subunit 8
Domestic Rabbit(100357640) integrator complex subunit 8
Zebrafish(553794) integrator complex subunit 8
cow(100124522) integrator complex subunit 8
Horse(100055266) integrator complex subunit 8
domestic cat(101085599) integrator complex subunit 8
dog(487056) integrator complex subunit 8
chicken(420230) integrator complex subunit 8
fruit fly(36886) Integrator 8
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA057299 Anti-INTS8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178112 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178112 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178112 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017864 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017864 Rosetta Predictions human pricing
NM_178112 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121952 predicted 336
2 SASI_Hs01_00121953 predicted 570
3 SASI_Hs01_00121954 predicted 1791
4 SASI_Hs01_00121955 predicted 1762
5 SASI_Hs01_00121956 predicted 1543
6 SASI_Hs01_00121957 predicted 1125
7 SASI_Hs01_00121958 predicted 578
8 SASI_Hs01_00121959 predicted 1637
9 SASI_Hs01_00121960 predicted 1061
10 SASI_Hs02_00350780 predicted 2570
11 SASI_Hs01_00121951 predicted 2357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083765 predicted 2940
2 SASI_Mm01_00083767 predicted 572
3 SASI_Mm01_00083768 predicted 1713
4 SASI_Mm01_00083769 predicted 1760
5 SASI_Mm01_00083770 predicted 560
6 SASI_Mm02_00348578 predicted 1629
7 SASI_Mm01_00083771 predicted 1123
8 SASI_Mm01_00083772 predicted 1191
9 SASI_Mm01_00083773 predicted 1654
10 SASI_Mm01_00083774 predicted 2575
11 SASI_Mm01_00083766 predicted 1796
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178112
VALIDATED
INTS8 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178112.4-1652s21c1
Sequence:CCGGGTTGGAACATCAGCTTATATTCTCGAGAATATAAGCTGATGTTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178112.4-2036s21c1
Sequence:CCGGCAGTAGGGTACGAGGATATTTCTCGAGAAATATCCTCGTACCCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215996    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178112.4-3109s1c1
Sequence:CCGGCATAACAGAGTCAATACAATACTCGAGTATTGTATTGACTCTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178112.4-3109s21c1
Sequence:CCGGCATAACAGAGTCAATACAATACTCGAGTATTGTATTGACTCTGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178112.4-1093s21c1
Sequence:CCGGCATACAGTCAAGTCCATATTTCTCGAGAAATATGGACTTGACTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178112.4-1190s21c1
Sequence:CCGGGTTCCGACAATCGGTATTAAGCTCGAGCTTAATACCGATTGTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178112.3-262s1c1
Sequence:CCGGGTTCAGCTTATAGTTCAGTTTCTCGAGAAACTGAACTATAAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178112.3-733s1c1
Sequence:CCGGGCTCTGAGATTAAACAAGGATCTCGAGATCCTTGTTTAATCTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178112.3-256s1c1
Sequence:CCGGGCACCAGTTCAGCTTATAGTTCTCGAGAACTATAAGCTGAACTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178112
VALIDATED
INTS8 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178112.4-1652s21c1
Sequence:CCGGGTTGGAACATCAGCTTATATTCTCGAGAATATAAGCTGATGTTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178112.4-2036s21c1
Sequence:CCGGCAGTAGGGTACGAGGATATTTCTCGAGAAATATCCTCGTACCCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215996    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178112.4-3109s1c1
Sequence:CCGGCATAACAGAGTCAATACAATACTCGAGTATTGTATTGACTCTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178112.4-3109s21c1
Sequence:CCGGCATAACAGAGTCAATACAATACTCGAGTATTGTATTGACTCTGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178112.4-1093s21c1
Sequence:CCGGCATACAGTCAAGTCCATATTTCTCGAGAAATATGGACTTGACTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178112.4-1190s21c1
Sequence:CCGGGTTCCGACAATCGGTATTAAGCTCGAGCTTAATACCGATTGTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178112.3-262s1c1
Sequence:CCGGGTTCAGCTTATAGTTCAGTTTCTCGAGAAACTGAACTATAAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178112.3-733s1c1
Sequence:CCGGGCTCTGAGATTAAACAAGGATCTCGAGATCCTTGTTTAATCTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178112.3-256s1c1
Sequence:CCGGGCACCAGTTCAGCTTATAGTTCTCGAGAACTATAAGCTGAACTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178112
VALIDATED
INTS8 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178112.4-1652s21c1
Sequence:CCGGGTTGGAACATCAGCTTATATTCTCGAGAATATAAGCTGATGTTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178112.4-2036s21c1
Sequence:CCGGCAGTAGGGTACGAGGATATTTCTCGAGAAATATCCTCGTACCCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215996    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178112.4-3109s1c1
Sequence:CCGGCATAACAGAGTCAATACAATACTCGAGTATTGTATTGACTCTGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246673    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178112.4-3109s21c1
Sequence:CCGGCATAACAGAGTCAATACAATACTCGAGTATTGTATTGACTCTGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178112.4-1093s21c1
Sequence:CCGGCATACAGTCAAGTCCATATTTCTCGAGAAATATGGACTTGACTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178112.4-1190s21c1
Sequence:CCGGGTTCCGACAATCGGTATTAAGCTCGAGCTTAATACCGATTGTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178112.3-262s1c1
Sequence:CCGGGTTCAGCTTATAGTTCAGTTTCTCGAGAAACTGAACTATAAGCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178112.3-733s1c1
Sequence:CCGGGCTCTGAGATTAAACAAGGATCTCGAGATCCTTGTTTAATCTCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180967    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178112.3-256s1c1
Sequence:CCGGGCACCAGTTCAGCTTATAGTTCTCGAGAACTATAAGCTGAACTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017864
VALIDATED
INTS8 MISSION shRNA Bacterial Glycerol Stock
integrator complex subunit 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-107s1c1
Sequence:CCGGGATGAAGAACGAAAGCTACTTCTCGAGAAGTAGCTTTCGTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017864.1-110s1c1
Sequence:CCGGGAAGAACGAAAGCTACTTGTTCTCGAGAACAAGTAGCTTTCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-1316s1c1
Sequence:CCGGGATGTTTATACAGACCAGGTACTCGAGTACCTGGTCTGTATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017864.1-151s1c1
Sequence:CCGGCCCTAGAGTAAATCTGTGCATCTCGAGATGCACAGATTTACTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017864.1-1405s1c1
Sequence:CCGGCCTCAGAGAAATTGACTACAACTCGAGTTGTAGTCAATTTCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017864.1-1312s1c1
Sequence:CCGGCCCTGATGTTTATACAGACCACTCGAGTGGTCTGTATAAACATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-1037s1c1
Sequence:CCGGCACAATGTTCGGGAGGACATTCTCGAGAATGTCCTCCCGAACATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-472s1c1
Sequence:CCGGCTTTGCTGCTTGTTTGGAGTTCTCGAGAACTCCAAACAAGCAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-788s1c1
Sequence:CCGGGCAGCTACATGCAAAGAACTTCTCGAGAAGTTCTTTGCATGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017864.1-1139s1c1
Sequence:CCGGGCAATCACAGTGAAAGAGCTACTCGAGTAGCTCTTTCACTGTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017864
VALIDATED
INTS8 MISSION shRNA shRNA Plasmid DNA
integrator complex subunit 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-107s1c1
Sequence:CCGGGATGAAGAACGAAAGCTACTTCTCGAGAAGTAGCTTTCGTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017864.1-110s1c1
Sequence:CCGGGAAGAACGAAAGCTACTTGTTCTCGAGAACAAGTAGCTTTCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-1316s1c1
Sequence:CCGGGATGTTTATACAGACCAGGTACTCGAGTACCTGGTCTGTATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017864.1-151s1c1
Sequence:CCGGCCCTAGAGTAAATCTGTGCATCTCGAGATGCACAGATTTACTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017864.1-1405s1c1
Sequence:CCGGCCTCAGAGAAATTGACTACAACTCGAGTTGTAGTCAATTTCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017864.1-1312s1c1
Sequence:CCGGCCCTGATGTTTATACAGACCACTCGAGTGGTCTGTATAAACATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-1037s1c1
Sequence:CCGGCACAATGTTCGGGAGGACATTCTCGAGAATGTCCTCCCGAACATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-472s1c1
Sequence:CCGGCTTTGCTGCTTGTTTGGAGTTCTCGAGAACTCCAAACAAGCAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-788s1c1
Sequence:CCGGGCAGCTACATGCAAAGAACTTCTCGAGAAGTTCTTTGCATGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017864.1-1139s1c1
Sequence:CCGGGCAATCACAGTGAAAGAGCTACTCGAGTAGCTCTTTCACTGTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017864
VALIDATED
INTS8 MISSION shRNA Lentiviral Transduction Particles
integrator complex subunit 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-107s1c1
Sequence:CCGGGATGAAGAACGAAAGCTACTTCTCGAGAAGTAGCTTTCGTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017864.1-110s1c1
Sequence:CCGGGAAGAACGAAAGCTACTTGTTCTCGAGAACAAGTAGCTTTCGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-1316s1c1
Sequence:CCGGGATGTTTATACAGACCAGGTACTCGAGTACCTGGTCTGTATAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017864.1-151s1c1
Sequence:CCGGCCCTAGAGTAAATCTGTGCATCTCGAGATGCACAGATTTACTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017864.1-1405s1c1
Sequence:CCGGCCTCAGAGAAATTGACTACAACTCGAGTTGTAGTCAATTTCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017864.1-1312s1c1
Sequence:CCGGCCCTGATGTTTATACAGACCACTCGAGTGGTCTGTATAAACATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-1037s1c1
Sequence:CCGGCACAATGTTCGGGAGGACATTCTCGAGAATGTCCTCCCGAACATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-472s1c1
Sequence:CCGGCTTTGCTGCTTGTTTGGAGTTCTCGAGAACTCCAAACAAGCAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017864.1-788s1c1
Sequence:CCGGGCAGCTACATGCAAAGAACTTCTCGAGAAGTTCTTTGCATGTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017864.1-1139s1c1
Sequence:CCGGGCAATCACAGTGAAAGAGCTACTCGAGTAGCTCTTTCACTGTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks