EMAIL THIS PAGE TO A FRIEND

IPCEF1

interaction protein for cytohesin exchange factors 1

Synonyms: PIP3-E RP3-402L9.2
UniProtKB ID: Q8WWN9, A8K1K2, B7ZL78, B7ZL80, O43153, Q5HYL8
Gene ID:
Mouse(320495) interaction protein for cytohesin exchange factors 1
Rat(361474) interaction protein for cytohesin exchange factors 1
domestic guinea pig(100712915) interaction protein for cytohesin exchange factors 1
naked mole-rat(101711087) interaction protein for cytohesin exchange factors 1
sheep(101107028) interaction protein for cytohesin exchange factors 1
chicken(421645) interaction protein for cytohesin exchange factors 1
cow(516875) interaction protein for cytohesin exchange factors 1
Horse(100062157) interaction protein for cytohesin exchange factors 1
165 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015553 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015553 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015553 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137251 MISSION® esiRNA esiRNA human IPCEF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015553 Rosetta Predictions human pricing
XM_341752 Rosetta Predictions rat pricing
NM_001033391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129396 predicted 1039
2 SASI_Hs01_00129397 predicted 609
3 SASI_Hs01_00129398 predicted 530
4 SASI_Hs01_00129399 predicted 1011
5 SASI_Hs01_00129400 predicted 587
6 SASI_Hs02_00348091 predicted 1178
7 SASI_Hs01_00129401 predicted 1004
8 SASI_Hs01_00129402 predicted 759
9 SASI_Hs01_00129403 predicted 1257
10 SASI_Hs01_00129404 predicted 1422
11 SASI_Hs01_00129405 predicted 982
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341752 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00183079 predicted 938
2 SASI_Rn01_00183080 predicted 1462
3 SASI_Rn01_00183081 predicted 1440
4 SASI_Rn01_00183082 predicted 1157
5 SASI_Rn01_00183083 predicted 1428
6 SASI_Rn01_00183084 predicted 1206
7 SASI_Rn01_00183085 predicted 1191
8 SASI_Rn01_00183086 predicted 935
9 SASI_Rn01_00183087 predicted 1149
10 SASI_Rn01_00183088 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100354 predicted 545
2 SASI_Mm01_00100355 predicted 520
3 SASI_Mm01_00100356 predicted 670
4 SASI_Mm01_00100357 predicted 607
5 SASI_Mm01_00100358 predicted 440
6 SASI_Mm01_00100359 predicted 605
7 SASI_Mm01_00100360 predicted 524
8 SASI_Mm01_00100361 predicted 670
9 SASI_Mm01_00100362 predicted 661
10 SASI_Mm01_00100363 predicted 519
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015553
IPCEF1 MISSION shRNA Bacterial Glycerol Stock
interaction protein for cytohesin exchange factors 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015553.1-530s1c1
Sequence:CCGGGCAGGAAATGAACGTGTGGTTCTCGAGAACCACACGTTCATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015553.1-730s1c1
Sequence:CCGGGAACGTCGTATTCTTTCTCTTCTCGAGAAGAGAAAGAATACGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015553.1-1232s1c1
Sequence:CCGGCCGAACATTGAATAGCACATTCTCGAGAATGTGCTATTCAATGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-1111s1c1
Sequence:CCGGCATTAGAGCAAGCTAGTCTATCTCGAGATAGACTAGCTTGCTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134838    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015553.1-4698s1c1
Sequence:CCGGCCTTACATTTACACAGCACTTCTCGAGAAGTGCTGTGTAAATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-531s1c1
Sequence:CCGGCAGGAAATGAACGTGTGGTTACTCGAGTAACCACACGTTCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-879s1c1
Sequence:CCGGGTGCAAGTTCATTCACCTGTACTCGAGTACAGGTGAATGAACTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-371s1c1
Sequence:CCGGGTCACTGTACTGGTATAGCAACTCGAGTTGCTATACCAGTACAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-1316s1c1
Sequence:CCGGCAGGAAATACAGAGAGTGGAACTCGAGTTCCACTCTCTGTATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015553.1-1013s1c1
Sequence:CCGGCCATCTTACTGTCCCAGATAACTCGAGTTATCTGGGACAGTAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015553.1-4816s1c1
Sequence:CCGGCCAGTGATGAAGCAGGAACTTCTCGAGAAGTTCCTGCTTCATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-246s1c1
Sequence:CCGGCGGAGGAGGATATCGTGTAAACTCGAGTTTACACGATATCCTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015553
IPCEF1 MISSION shRNA shRNA Plasmid DNA
interaction protein for cytohesin exchange factors 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015553.1-530s1c1
Sequence:CCGGGCAGGAAATGAACGTGTGGTTCTCGAGAACCACACGTTCATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015553.1-730s1c1
Sequence:CCGGGAACGTCGTATTCTTTCTCTTCTCGAGAAGAGAAAGAATACGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015553.1-1232s1c1
Sequence:CCGGCCGAACATTGAATAGCACATTCTCGAGAATGTGCTATTCAATGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-1111s1c1
Sequence:CCGGCATTAGAGCAAGCTAGTCTATCTCGAGATAGACTAGCTTGCTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134838    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015553.1-4698s1c1
Sequence:CCGGCCTTACATTTACACAGCACTTCTCGAGAAGTGCTGTGTAAATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-531s1c1
Sequence:CCGGCAGGAAATGAACGTGTGGTTACTCGAGTAACCACACGTTCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-879s1c1
Sequence:CCGGGTGCAAGTTCATTCACCTGTACTCGAGTACAGGTGAATGAACTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-371s1c1
Sequence:CCGGGTCACTGTACTGGTATAGCAACTCGAGTTGCTATACCAGTACAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-1316s1c1
Sequence:CCGGCAGGAAATACAGAGAGTGGAACTCGAGTTCCACTCTCTGTATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015553.1-1013s1c1
Sequence:CCGGCCATCTTACTGTCCCAGATAACTCGAGTTATCTGGGACAGTAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015553.1-4816s1c1
Sequence:CCGGCCAGTGATGAAGCAGGAACTTCTCGAGAAGTTCCTGCTTCATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-246s1c1
Sequence:CCGGCGGAGGAGGATATCGTGTAAACTCGAGTTTACACGATATCCTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015553
IPCEF1 MISSION shRNA Lentiviral Transduction Particles
interaction protein for cytohesin exchange factors 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015553.1-530s1c1
Sequence:CCGGGCAGGAAATGAACGTGTGGTTCTCGAGAACCACACGTTCATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015553.1-730s1c1
Sequence:CCGGGAACGTCGTATTCTTTCTCTTCTCGAGAAGAGAAAGAATACGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015553.1-1232s1c1
Sequence:CCGGCCGAACATTGAATAGCACATTCTCGAGAATGTGCTATTCAATGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-1111s1c1
Sequence:CCGGCATTAGAGCAAGCTAGTCTATCTCGAGATAGACTAGCTTGCTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134838    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015553.1-4698s1c1
Sequence:CCGGCCTTACATTTACACAGCACTTCTCGAGAAGTGCTGTGTAAATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136577    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-531s1c1
Sequence:CCGGCAGGAAATGAACGTGTGGTTACTCGAGTAACCACACGTTCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-879s1c1
Sequence:CCGGGTGCAAGTTCATTCACCTGTACTCGAGTACAGGTGAATGAACTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136672    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-371s1c1
Sequence:CCGGGTCACTGTACTGGTATAGCAACTCGAGTTGCTATACCAGTACAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-1316s1c1
Sequence:CCGGCAGGAAATACAGAGAGTGGAACTCGAGTTCCACTCTCTGTATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015553.1-1013s1c1
Sequence:CCGGCCATCTTACTGTCCCAGATAACTCGAGTTATCTGGGACAGTAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015553.1-4816s1c1
Sequence:CCGGCCAGTGATGAAGCAGGAACTTCTCGAGAAGTTCCTGCTTCATCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015553.1-246s1c1
Sequence:CCGGCGGAGGAGGATATCGTGTAAACTCGAGTTTACACGATATCCTCCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033391
IPCEF1 MISSION shRNA Bacterial Glycerol Stock
interaction protein for cytohesin exchange factors 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033391.2-177s21c1
Sequence:CCGGTCAATCACCCACAGATCAAAGCTCGAGCTTTGATCTGTGGGTGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033391.2-399s21c1
Sequence:CCGGCATCTTCTTCTTCACCTAAACCTCGAGGTTTAGGTGAAGAAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033391.2-697s21c1
Sequence:CCGGTAACAATAAAGACCATCTAACCTCGAGGTTAGATGGTCTTTATTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033391.2-509s21c1
Sequence:CCGGTCCTGGCACAACATAGTTAACCTCGAGGTTAACTATGTTGTGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033391.2-934s21c1
Sequence:CCGGTATTAGCCACTGGCATGTATACTCGAGTATACATGCCAGTGGCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033391
IPCEF1 MISSION shRNA shRNA Plasmid DNA
interaction protein for cytohesin exchange factors 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033391.2-177s21c1
Sequence:CCGGTCAATCACCCACAGATCAAAGCTCGAGCTTTGATCTGTGGGTGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033391.2-399s21c1
Sequence:CCGGCATCTTCTTCTTCACCTAAACCTCGAGGTTTAGGTGAAGAAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033391.2-697s21c1
Sequence:CCGGTAACAATAAAGACCATCTAACCTCGAGGTTAGATGGTCTTTATTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033391.2-509s21c1
Sequence:CCGGTCCTGGCACAACATAGTTAACCTCGAGGTTAACTATGTTGTGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033391.2-934s21c1
Sequence:CCGGTATTAGCCACTGGCATGTATACTCGAGTATACATGCCAGTGGCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033391
IPCEF1 MISSION shRNA Lentiviral Transduction Particles
interaction protein for cytohesin exchange factors 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033391.2-177s21c1
Sequence:CCGGTCAATCACCCACAGATCAAAGCTCGAGCTTTGATCTGTGGGTGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033391.2-399s21c1
Sequence:CCGGCATCTTCTTCTTCACCTAAACCTCGAGGTTTAGGTGAAGAAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033391.2-697s21c1
Sequence:CCGGTAACAATAAAGACCATCTAACCTCGAGGTTAGATGGTCTTTATTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033391.2-509s21c1
Sequence:CCGGTCCTGGCACAACATAGTTAACCTCGAGGTTAACTATGTTGTGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033391.2-934s21c1
Sequence:CCGGTATTAGCCACTGGCATGTATACTCGAGTATACATGCCAGTGGCTAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks