EMAIL THIS PAGE TO A FRIEND

IQCA1

IQ motif containing with AAA domain 1

Synonyms: 4930465P12Rik IQCA
Gene ID:
Human(79781) Summary: The protein encoded by this gene is a member of the ATPases Associated with diverse cellular Activities (AAA) superfamily. Members of this superfamily, found in all organisms, participate in a large number of cellular processes and contain the ATPase module consisting of an alpha-beta-alpha core domain and the Walker A and B motifs of the P-loop NTPases. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
Rat(316616) IQ motif containing with AAA domain 1
sheep(101103100) IQ motif containing with AAA domain 1
Domestic Rabbit(100354398) IQ motif containing with AAA domain 1
domestic guinea pig(100716936) IQ motif containing with AAA domain 1
naked mole-rat(101699101) IQ motif containing with AAA domain 1
Zebrafish(553364) IQ motif containing with AAA domain 1
dog(477415) IQ motif containing with AAA domain 1
domestic cat(101086919) IQ motif containing with AAA domain 1
cow(618101) IQ motif containing with AAA domain 1
Horse(100066104) IQ motif containing with AAA domain 1
chicken(424021) IQ motif containing with AAA domain 1
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024726 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068731 MISSION® esiRNA esiRNA human IQCA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024726 Rosetta Predictions human pricing
XM_001066515 Rosetta Predictions rat pricing
XM_237386 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106548 predicted 609
2 SASI_Hs01_00106549 predicted 658
3 SASI_Hs01_00106550 predicted 2294
4 SASI_Hs02_00357197 predicted 1967
5 SASI_Hs01_00106551 predicted 2182
6 SASI_Hs01_00106552 predicted 1868
7 SASI_Hs01_00106553 predicted 466
8 SASI_Hs01_00106554 predicted 632
9 SASI_Hs01_00106555 predicted 870
10 SASI_Hs01_00106556 predicted 2225
11 SASI_Hs01_00106557 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00317749 predicted 1410
2 SASI_Rn02_00317750 predicted 758
3 SASI_Rn02_00317751 predicted 1448
4 SASI_Rn02_00317752 predicted 1675
5 SASI_Rn02_00317753 predicted 1657
6 SASI_Rn02_00317754 predicted 805
7 SASI_Rn02_00317755 predicted 1903
8 SASI_Rn02_00317756 predicted 247
9 SASI_Rn02_00317757 predicted 318
10 SASI_Rn02_00317758 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_237386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390857 predicted 2848
2 SASI_Rn02_00390858 predicted 289
3 SASI_Rn02_00390859 predicted 868
4 SASI_Rn02_00390860 predicted 2825
5 SASI_Rn02_00390861 predicted 804
6 SASI_Rn02_00390862 predicted 322
7 SASI_Rn02_00390863 predicted 562
8 SASI_Rn02_00390864 predicted 543
9 SASI_Rn02_00390865 predicted 385
10 SASI_Rn02_00390866 predicted 916
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024726
IQCA1 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing with AAA domain 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024726.3-3045s21c1
Sequence:CCGGTTAGTAAGCAATGAGTATATCCTCGAGGATATACTCATTGCTTACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024726.3-1180s21c1
Sequence:CCGGAGACCATACAACAGGTTATTGCTCGAGCAATAACCTGTTGTATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024726.3-230s21c1
Sequence:CCCGCCTCGGTGCTTTACTCGATAACTCGAGTTATCGAGTAAAGCACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024726.3-305s21c1
Sequence:CCGGATTAGCCACCTTCTACGTAAACTCGAGTTTACGTAGAAGGTGGCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024726.3-603s21c1
Sequence:CCGGATATTAGCGGACAGCGGAATACTCGAGTATTCCGCTGTCCGCTAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024726.3-2233s1c1
Sequence:CCGGCCTTCGATGCTGAACTCCAATCTCGAGATTGGAGTTCAGCATCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024726.3-2549s1c1
Sequence:CCGGCTTTAAGAACTGGTATGCCAACTCGAGTTGGCATACCAGTTCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024726.3-1985s1c1
Sequence:CCGGCTCTAACATTGCTGGGAAATACTCGAGTATTTCCCAGCAATGTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024726.3-2408s1c1
Sequence:CCGGCCAAGGACATATAGTCGAAGTCTCGAGACTTCGACTATATGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024726.3-2523s1c1
Sequence:CCGGCCAGTGTACAAAGAGGAAGAACTCGAGTTCTTCCTCTTTGTACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024726.3-2903s1c1
Sequence:CCGGGCTTTAATCCACGCCAAGTTTCTCGAGAAACTTGGCGTGGATTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024726
IQCA1 MISSION shRNA shRNA Plasmid DNA
IQ motif containing with AAA domain 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024726.3-3045s21c1
Sequence:CCGGTTAGTAAGCAATGAGTATATCCTCGAGGATATACTCATTGCTTACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024726.3-1180s21c1
Sequence:CCGGAGACCATACAACAGGTTATTGCTCGAGCAATAACCTGTTGTATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024726.3-230s21c1
Sequence:CCCGCCTCGGTGCTTTACTCGATAACTCGAGTTATCGAGTAAAGCACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024726.3-305s21c1
Sequence:CCGGATTAGCCACCTTCTACGTAAACTCGAGTTTACGTAGAAGGTGGCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024726.3-603s21c1
Sequence:CCGGATATTAGCGGACAGCGGAATACTCGAGTATTCCGCTGTCCGCTAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024726.3-2233s1c1
Sequence:CCGGCCTTCGATGCTGAACTCCAATCTCGAGATTGGAGTTCAGCATCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024726.3-2549s1c1
Sequence:CCGGCTTTAAGAACTGGTATGCCAACTCGAGTTGGCATACCAGTTCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024726.3-1985s1c1
Sequence:CCGGCTCTAACATTGCTGGGAAATACTCGAGTATTTCCCAGCAATGTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024726.3-2408s1c1
Sequence:CCGGCCAAGGACATATAGTCGAAGTCTCGAGACTTCGACTATATGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024726.3-2523s1c1
Sequence:CCGGCCAGTGTACAAAGAGGAAGAACTCGAGTTCTTCCTCTTTGTACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024726.3-2903s1c1
Sequence:CCGGGCTTTAATCCACGCCAAGTTTCTCGAGAAACTTGGCGTGGATTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024726
IQCA1 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing with AAA domain 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430348    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024726.3-3045s21c1
Sequence:CCGGTTAGTAAGCAATGAGTATATCCTCGAGGATATACTCATTGCTTACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024726.3-1180s21c1
Sequence:CCGGAGACCATACAACAGGTTATTGCTCGAGCAATAACCTGTTGTATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024726.3-230s21c1
Sequence:CCCGCCTCGGTGCTTTACTCGATAACTCGAGTTATCGAGTAAAGCACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024726.3-305s21c1
Sequence:CCGGATTAGCCACCTTCTACGTAAACTCGAGTTTACGTAGAAGGTGGCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024726.3-603s21c1
Sequence:CCGGATATTAGCGGACAGCGGAATACTCGAGTATTCCGCTGTCCGCTAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024726.3-2233s1c1
Sequence:CCGGCCTTCGATGCTGAACTCCAATCTCGAGATTGGAGTTCAGCATCGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024726.3-2549s1c1
Sequence:CCGGCTTTAAGAACTGGTATGCCAACTCGAGTTGGCATACCAGTTCTTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024726.3-1985s1c1
Sequence:CCGGCTCTAACATTGCTGGGAAATACTCGAGTATTTCCCAGCAATGTTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024726.3-2408s1c1
Sequence:CCGGCCAAGGACATATAGTCGAAGTCTCGAGACTTCGACTATATGTCCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024726.3-2523s1c1
Sequence:CCGGCCAGTGTACAAAGAGGAAGAACTCGAGTTCTTCCTCTTTGTACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024726.3-2903s1c1
Sequence:CCGGGCTTTAATCCACGCCAAGTTTCTCGAGAAACTTGGCGTGGATTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks