EMAIL THIS PAGE TO A FRIEND

IQCB1

IQ motif containing B1

Synonyms: NPHP5 PIQ SLSN5
UniProtKB ID: Q15051, Q3KS08, Q3KS09, Q5DKQ7, Q8NI79, Q9BS08
Gene ID:
Human(9657) Summary: This gene encodes a nephrocystin protein that interacts with calmodulin and the retinitis pigmentosa GTPase regulator protein. The encoded protein has a central coiled-coil region and two calmodulin-binding IQ domains. It is localized to the primary cilia of renal epithelial cells and connecting cilia of photoreceptor cells. The protein is thought to play a role in ciliary function. Defects in this gene result in Senior-Loken syndrome type 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
Mouse(320299) IQ calmodulin-binding motif containing 1
Rat(303915) IQ motif containing B1
Zebrafish(494079) IQ motif containing B1
cow(534598) IQ motif containing B1
Horse(100060805) IQ motif containing B1
domestic cat(101085146) IQ motif containing B1
dog(478582) IQ motif containing B1
chicken(424242) IQ motif containing B1
domestic guinea pig(100723725) IQ motif containing B1
naked mole-rat(101721269) IQ motif containing B1
sheep(101110893) IQ motif containing B1
Domestic Rabbit(100339750) IQ motif containing B1
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014642 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014642 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014642 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001023571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001023571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001023571 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177128 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177128 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177128 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001023570 Rosetta Predictions human pricing
NM_001023571 Rosetta Predictions human pricing
NM_001107092 Rosetta Predictions rat pricing
NM_177128 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001023570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067505 predicted 406
2 SASI_Hs02_00307090 predicted 1585
3 SASI_Hs02_00307091 predicted 1479
4 SASI_Hs01_00067508 predicted 1723
5 SASI_Hs01_00067510 predicted 2019
6 SASI_Hs01_00067511 predicted 1995
7 SASI_Hs02_00307092 predicted 1453
8 SASI_Hs01_00067513 predicted 445
9 SASI_Hs01_00067514 predicted 1993
10 SASI_Hs02_00307093 predicted 1614
11 SASI_Hs01_00067506 predicted 330
12 SASI_Hs01_00067507 predicted 1762
13 SASI_Hs01_00067509 predicted 2013
14 SASI_Hs01_00067512 predicted 2003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001023571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219976 predicted 403
2 SASI_Hs02_00307094 predicted 1187
3 SASI_Hs02_00307095 predicted 1074
4 SASI_Hs01_00219979 predicted 1324
5 SASI_Hs01_00219981 predicted 1625
6 SASI_Hs01_00219982 predicted 1604
7 SASI_Hs02_00307096 predicted 1061
8 SASI_Hs01_00219984 predicted 442
9 SASI_Hs01_00219985 predicted 1600
10 SASI_Hs02_00307097 predicted 1215
11 SASI_Hs01_00219977 predicted 271
12 SASI_Hs01_00219978 predicted 1320
13 SASI_Hs01_00219980 predicted 1558
14 SASI_Hs01_00219983 predicted 1560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225416 predicted 691
2 SASI_Rn02_00225417 predicted 259
3 SASI_Rn02_00225418 predicted 430
4 SASI_Rn02_00225419 predicted 872
5 SASI_Rn02_00225420 predicted 1684
6 SASI_Rn02_00225421 predicted 312
7 SASI_Rn02_00225422 predicted 596
8 SASI_Rn02_00225423 predicted 1244
9 SASI_Rn02_00225424 predicted 288
10 SASI_Rn02_00225425 predicted 1359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177128 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130900 predicted 1689
2 SASI_Mm01_00130901 predicted 1972
3 SASI_Mm01_00130902 predicted 735
4 SASI_Mm01_00130903 predicted 927
5 SASI_Mm01_00130904 predicted 344
6 SASI_Mm02_00347121 predicted 418
7 SASI_Mm01_00130905 predicted 1948
8 SASI_Mm01_00130906 predicted 400
9 SASI_Mm01_00130908 predicted 618
10 SASI_Mm01_00130909 predicted 1411
11 SASI_Mm01_00130907 predicted 1782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014642
VALIDATED
IQCB1 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing B1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014642.2-1079s1c1
Sequence:CCGGGAGCAGATCCAAACGATCAAACTCGAGTTTGATCGTTTGGATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014642.2-1280s1c1
Sequence:CCGGCCAGAAACATTGGAGAGGGTACTCGAGTACCCTCTCCAATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014642.2-732s1c1
Sequence:CCGGCTGACAATGTCCAAATAGGATCTCGAGATCCTATTTGGACATTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014642.2-272s1c1
Sequence:CCGGGAGCAGAATGTCCCTGTTATACTCGAGTATAACAGGGACATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014642.2-1331s1c1
Sequence:CCGGGCAGTCTCTCATAGAGTATAACTCGAGTTATACTCTATGAGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014642.2-728s1c1
Sequence:CCGGCAAGCTGACAATGTCCAAATACTCGAGTATTTGGACATTGTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014642
VALIDATED
IQCB1 MISSION shRNA shRNA Plasmid DNA
IQ motif containing B1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014642.2-1079s1c1
Sequence:CCGGGAGCAGATCCAAACGATCAAACTCGAGTTTGATCGTTTGGATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014642.2-1280s1c1
Sequence:CCGGCCAGAAACATTGGAGAGGGTACTCGAGTACCCTCTCCAATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014642.2-732s1c1
Sequence:CCGGCTGACAATGTCCAAATAGGATCTCGAGATCCTATTTGGACATTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014642.2-272s1c1
Sequence:CCGGGAGCAGAATGTCCCTGTTATACTCGAGTATAACAGGGACATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014642.2-1331s1c1
Sequence:CCGGGCAGTCTCTCATAGAGTATAACTCGAGTTATACTCTATGAGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014642.2-728s1c1
Sequence:CCGGCAAGCTGACAATGTCCAAATACTCGAGTATTTGGACATTGTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014642
VALIDATED
IQCB1 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing B1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014642.2-1079s1c1
Sequence:CCGGGAGCAGATCCAAACGATCAAACTCGAGTTTGATCGTTTGGATCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014642.2-1280s1c1
Sequence:CCGGCCAGAAACATTGGAGAGGGTACTCGAGTACCCTCTCCAATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014642.2-732s1c1
Sequence:CCGGCTGACAATGTCCAAATAGGATCTCGAGATCCTATTTGGACATTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014642.2-272s1c1
Sequence:CCGGGAGCAGAATGTCCCTGTTATACTCGAGTATAACAGGGACATTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128434    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014642.2-1331s1c1
Sequence:CCGGGCAGTCTCTCATAGAGTATAACTCGAGTTATACTCTATGAGAGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014642.2-728s1c1
Sequence:CCGGCAAGCTGACAATGTCCAAATACTCGAGTATTTGGACATTGTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001023571
VALIDATED
IQCB1 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing B1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001023571.2-735s21c1
Sequence:CCGGCAAGCTGACAATGTCCAAATACTCGAGTATTTGGACATTGTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023571.2-916s21c1
Sequence:CCGGAGCTGAGTATGCTCGAAATAGCTCGAGCTATTTCGAGCATACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001023571.2-1689s21c1
Sequence:CCGGACTAGGGCCATCCTAACTTATCTCGAGATAAGTTAGGATGGCCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023571.2-1049s21c1
Sequence:CCGGGCAGTCTCTCATAGAGTATAACTCGAGTTATACTCTATGAGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001023571.2-701s21c1
Sequence:CCGGTGTACTACAAAGTGATCATTTCTCGAGAAATGATCACTTTGTAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001023571
VALIDATED
IQCB1 MISSION shRNA shRNA Plasmid DNA
IQ motif containing B1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001023571.2-735s21c1
Sequence:CCGGCAAGCTGACAATGTCCAAATACTCGAGTATTTGGACATTGTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023571.2-916s21c1
Sequence:CCGGAGCTGAGTATGCTCGAAATAGCTCGAGCTATTTCGAGCATACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001023571.2-1689s21c1
Sequence:CCGGACTAGGGCCATCCTAACTTATCTCGAGATAAGTTAGGATGGCCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023571.2-1049s21c1
Sequence:CCGGGCAGTCTCTCATAGAGTATAACTCGAGTTATACTCTATGAGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001023571.2-701s21c1
Sequence:CCGGTGTACTACAAAGTGATCATTTCTCGAGAAATGATCACTTTGTAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001023571
VALIDATED
IQCB1 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing B1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001023571.2-735s21c1
Sequence:CCGGCAAGCTGACAATGTCCAAATACTCGAGTATTTGGACATTGTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023571.2-916s21c1
Sequence:CCGGAGCTGAGTATGCTCGAAATAGCTCGAGCTATTTCGAGCATACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001023571.2-1689s21c1
Sequence:CCGGACTAGGGCCATCCTAACTTATCTCGAGATAAGTTAGGATGGCCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001023571.2-1049s21c1
Sequence:CCGGGCAGTCTCTCATAGAGTATAACTCGAGTTATACTCTATGAGAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001023571.2-701s21c1
Sequence:CCGGTGTACTACAAAGTGATCATTTCTCGAGAAATGATCACTTTGTAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177128
VALIDATED
IQCB1 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing B1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177128.3-913s21c1
Sequence:CCGGAGACTAAGTGCCTGCTATAAACTCGAGTTTATAGCAGGCACTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177128.3-654s21c1
Sequence:CCGGTGTACTGCAGAGTGATCATTTCTCGAGAAATGATCACTCTGCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177128.3-935s21c1
Sequence:CCGGGACTTAGAAGTCTGCTAAATACTCGAGTATTTAGCAGACTTCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177128.3-1544s21c1
Sequence:CCGGAGCAACAAGTGGACGATTATGCTCGAGCATAATCGTCCACTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177128.3-1973s21c1
Sequence:CCGGTGTGAAAGCTGGCAATCTTACCTCGAGGTAAGATTGCCAGCTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177128
VALIDATED
IQCB1 MISSION shRNA shRNA Plasmid DNA
IQ motif containing B1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177128.3-913s21c1
Sequence:CCGGAGACTAAGTGCCTGCTATAAACTCGAGTTTATAGCAGGCACTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177128.3-654s21c1
Sequence:CCGGTGTACTGCAGAGTGATCATTTCTCGAGAAATGATCACTCTGCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177128.3-935s21c1
Sequence:CCGGGACTTAGAAGTCTGCTAAATACTCGAGTATTTAGCAGACTTCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177128.3-1544s21c1
Sequence:CCGGAGCAACAAGTGGACGATTATGCTCGAGCATAATCGTCCACTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177128.3-1973s21c1
Sequence:CCGGTGTGAAAGCTGGCAATCTTACCTCGAGGTAAGATTGCCAGCTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177128
VALIDATED
IQCB1 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing B1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177128.3-913s21c1
Sequence:CCGGAGACTAAGTGCCTGCTATAAACTCGAGTTTATAGCAGGCACTTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177128.3-654s21c1
Sequence:CCGGTGTACTGCAGAGTGATCATTTCTCGAGAAATGATCACTCTGCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177128.3-935s21c1
Sequence:CCGGGACTTAGAAGTCTGCTAAATACTCGAGTATTTAGCAGACTTCTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177128.3-1544s21c1
Sequence:CCGGAGCAACAAGTGGACGATTATGCTCGAGCATAATCGTCCACTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248093    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177128.3-1973s21c1
Sequence:CCGGTGTGAAAGCTGGCAATCTTACCTCGAGGTAAGATTGCCAGCTTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks