EMAIL THIS PAGE TO A FRIEND

IQCC

IQ motif containing C

Synonyms: RP4-622L5.6
Gene ID:
Mouse(230767) IQ motif containing C
Rat(682431) IQ motif containing C
Zebrafish(799312) IQ motif containing C
chicken(419646) IQ motif containing C
domestic cat(101080985) IQ motif containing C
cow(507606) IQ motif containing C
dog(487311) IQ motif containing C
sheep(101116634) IQ motif containing C
domestic guinea pig(100730191) IQ motif containing C
naked mole-rat(101713475) IQ motif containing C
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198026 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198026 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198026 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018134 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018134 Rosetta Predictions human pricing
NM_198026 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053680 predicted 1036
2 SASI_Hs01_00053682 predicted 778
3 SASI_Hs01_00053683 predicted 1033
4 SASI_Hs01_00053684 predicted 547
5 SASI_Hs01_00053685 predicted 1299
6 SASI_Hs01_00053686 predicted 1320
7 SASI_Hs01_00053687 predicted 1256
8 SASI_Hs01_00053688 predicted 1143
9 SASI_Hs02_00351351 predicted 438
10 SASI_Hs01_00053689 predicted 560
11 SASI_Hs01_00053681 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198026 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188250 predicted 1121
2 SASI_Mm02_00350758 predicted 645
3 SASI_Mm01_00188249 predicted 1232
4 SASI_Mm02_00350759 predicted 1273
5 SASI_Mm01_00188251 predicted 576
6 SASI_Mm01_00188252 predicted 556
7 SASI_Mm01_00188255 predicted 268
8 SASI_Mm02_00350760 predicted 1296
9 SASI_Mm01_00188257 predicted 704
10 SASI_Mm01_00188258 predicted 1289
11 SASI_Mm01_00188253 predicted 1094
12 SASI_Mm01_00188254 predicted 622
13 SASI_Mm01_00188256 predicted 1114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198026
IQCC MISSION shRNA Bacterial Glycerol Stock
IQ motif containing C
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198026.2-567s21c1
Sequence:CCGGAGTCGAAAGGAGTACCTAATTCTCGAGAATTAGGTACTCCTTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198026.2-1170s21c1
Sequence:CCGGCTGGATCTCATTAGGACTAAACTCGAGTTTAGTCCTAATGAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198026.2-1115s1c1
Sequence:CCGGCTTAGAAGGCCACATGATTTGCTCGAGCAAATCATGTGGCCTTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198026.2-1800s21c1
Sequence:CCGGGCCACATCGTGTCTGTCATTGCTCGAGCAATGACAGACACGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198026.2-683s21c1
Sequence:CCGGTCTGGACAACCAATCCTATAGCTCGAGCTATAGGATTGGTTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198026.1-669s1c1
Sequence:CCGGCCAATCCTATAGAGACAGGATCTCGAGATCCTGTCTCTATAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198026
IQCC MISSION shRNA shRNA Plasmid DNA
IQ motif containing C
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198026.2-567s21c1
Sequence:CCGGAGTCGAAAGGAGTACCTAATTCTCGAGAATTAGGTACTCCTTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198026.2-1170s21c1
Sequence:CCGGCTGGATCTCATTAGGACTAAACTCGAGTTTAGTCCTAATGAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198026.2-1115s1c1
Sequence:CCGGCTTAGAAGGCCACATGATTTGCTCGAGCAAATCATGTGGCCTTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198026.2-1800s21c1
Sequence:CCGGGCCACATCGTGTCTGTCATTGCTCGAGCAATGACAGACACGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198026.2-683s21c1
Sequence:CCGGTCTGGACAACCAATCCTATAGCTCGAGCTATAGGATTGGTTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198026.1-669s1c1
Sequence:CCGGCCAATCCTATAGAGACAGGATCTCGAGATCCTGTCTCTATAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198026
IQCC MISSION shRNA Lentiviral Transduction Particles
IQ motif containing C
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198026.2-567s21c1
Sequence:CCGGAGTCGAAAGGAGTACCTAATTCTCGAGAATTAGGTACTCCTTTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198026.2-1170s21c1
Sequence:CCGGCTGGATCTCATTAGGACTAAACTCGAGTTTAGTCCTAATGAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198026.2-1115s1c1
Sequence:CCGGCTTAGAAGGCCACATGATTTGCTCGAGCAAATCATGTGGCCTTCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198026.2-1800s21c1
Sequence:CCGGGCCACATCGTGTCTGTCATTGCTCGAGCAATGACAGACACGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198026.2-683s21c1
Sequence:CCGGTCTGGACAACCAATCCTATAGCTCGAGCTATAGGATTGGTTGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201119    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198026.1-669s1c1
Sequence:CCGGCCAATCCTATAGAGACAGGATCTCGAGATCCTGTCTCTATAGGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018134
IQCC MISSION shRNA Bacterial Glycerol Stock
IQ motif containing C
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018134.1-1041s21c1
Sequence:CCGGGCACTCTATGAGGACTCAAATCTCGAGATTTGAGTCCTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018134.1-852s21c1
Sequence:CCGGTCTGGACCACCGTCGTCTATACTCGAGTATAGACGACGGTGGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018134.1-225s21c1
Sequence:CCGGGCAGGAGACAGGGTAGCAAATCTCGAGATTTGCTACCCTGTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018134.1-1302s21c1
Sequence:CCGGACTATACCATGGAGATCAAAGCTCGAGCTTTGATCTCCATGGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018134.1-1562s21c1
Sequence:CCGGCAGAGAGCTGGCATGAGTATACTCGAGTATACTCATGCCAGCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018134.1-918s1c1
Sequence:CCGGGACGATGGAAGACAGACCTTTCTCGAGAAAGGTCTGTCTTCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018134.1-1858s1c1
Sequence:CCGGCAGGAGATGGAGATTGCAGTACTCGAGTACTGCAATCTCCATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018134.1-1271s1c1
Sequence:CCGGGCCTAGTCATGAAGGACAGAACTCGAGTTCTGTCCTTCATGACTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018134.1-1734s1c1
Sequence:CCGGGCCTGACCAACATGGTGAAATCTCGAGATTTCACCATGTTGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018134
IQCC MISSION shRNA shRNA Plasmid DNA
IQ motif containing C
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018134.1-1041s21c1
Sequence:CCGGGCACTCTATGAGGACTCAAATCTCGAGATTTGAGTCCTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018134.1-852s21c1
Sequence:CCGGTCTGGACCACCGTCGTCTATACTCGAGTATAGACGACGGTGGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018134.1-225s21c1
Sequence:CCGGGCAGGAGACAGGGTAGCAAATCTCGAGATTTGCTACCCTGTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018134.1-1302s21c1
Sequence:CCGGACTATACCATGGAGATCAAAGCTCGAGCTTTGATCTCCATGGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018134.1-1562s21c1
Sequence:CCGGCAGAGAGCTGGCATGAGTATACTCGAGTATACTCATGCCAGCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018134.1-918s1c1
Sequence:CCGGGACGATGGAAGACAGACCTTTCTCGAGAAAGGTCTGTCTTCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018134.1-1858s1c1
Sequence:CCGGCAGGAGATGGAGATTGCAGTACTCGAGTACTGCAATCTCCATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018134.1-1271s1c1
Sequence:CCGGGCCTAGTCATGAAGGACAGAACTCGAGTTCTGTCCTTCATGACTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018134.1-1734s1c1
Sequence:CCGGGCCTGACCAACATGGTGAAATCTCGAGATTTCACCATGTTGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018134
IQCC MISSION shRNA Lentiviral Transduction Particles
IQ motif containing C
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018134.1-1041s21c1
Sequence:CCGGGCACTCTATGAGGACTCAAATCTCGAGATTTGAGTCCTCATAGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018134.1-852s21c1
Sequence:CCGGTCTGGACCACCGTCGTCTATACTCGAGTATAGACGACGGTGGTCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018134.1-225s21c1
Sequence:CCGGGCAGGAGACAGGGTAGCAAATCTCGAGATTTGCTACCCTGTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018134.1-1302s21c1
Sequence:CCGGACTATACCATGGAGATCAAAGCTCGAGCTTTGATCTCCATGGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018134.1-1562s21c1
Sequence:CCGGCAGAGAGCTGGCATGAGTATACTCGAGTATACTCATGCCAGCTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018134.1-918s1c1
Sequence:CCGGGACGATGGAAGACAGACCTTTCTCGAGAAAGGTCTGTCTTCCATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018134.1-1858s1c1
Sequence:CCGGCAGGAGATGGAGATTGCAGTACTCGAGTACTGCAATCTCCATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018134.1-1271s1c1
Sequence:CCGGGCCTAGTCATGAAGGACAGAACTCGAGTTCTGTCCTTCATGACTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136653    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018134.1-1734s1c1
Sequence:CCGGGCCTGACCAACATGGTGAAATCTCGAGATTTCACCATGTTGGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks