EMAIL THIS PAGE TO A FRIEND

IQCE

IQ motif containing E

Synonyms: 1700028P05Rik
UniProtKB ID: Q6IPM2, Q4G0P7, Q6P7T4, Q9H0H7, Q9UPX7
Gene ID:
Mouse(74239) IQ motif containing E
Rat(304318) IQ motif containing E
chicken(416473) IQ motif containing E
cow(618833) IQ motif containing E
dog(489889) IQ motif containing E
sheep(101111855) IQ motif containing E
domestic guinea pig(100726754) IQ motif containing E
naked mole-rat(101698803) IQ motif containing E
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA019515 Anti-IQCE antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2101172 Anti-IQCE antibody produced in rabbit affinity isolated antibody mouse, horse, guinea pig, canine, human, rabbit, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152558 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028833 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028833 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028833 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100390 Rosetta Predictions human pricing
NM_152558 Rosetta Predictions human pricing
XM_001073653 Rosetta Predictions rat pricing
XM_221965 Rosetta Predictions rat pricing
NM_028833 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321864 predicted 572
2 SASI_Hs02_00321865 predicted 848
3 SASI_Hs02_00321866 predicted 560
4 SASI_Hs02_00321867 predicted 2293
5 SASI_Hs02_00321868 predicted 2377
6 SASI_Hs02_00321869 predicted 2163
7 SASI_Hs02_00321870 predicted 2201
8 SASI_Hs02_00321871 predicted 2377
9 SASI_Hs02_00321872 predicted 2311
10 SASI_Hs02_00321873 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029189 predicted 619
2 SASI_Hs01_00029190 predicted 888
3 SASI_Hs01_00029191 predicted 613
4 SASI_Hs01_00029193 predicted 2340
5 SASI_Hs02_00366373 predicted 2426
6 SASI_Hs01_00029194 predicted 2205
7 SASI_Hs01_00029195 predicted 2250
8 SASI_Hs02_00366374 predicted 2428
9 SASI_Hs01_00029196 predicted 2356
10 SASI_Hs01_00029197 predicted 981
11 SASI_Hs01_00029188 predicted 258
12 SASI_Hs01_00029192 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343433 predicted 1631
2 SASI_Rn02_00343434 predicted 652
3 SASI_Rn02_00343435 predicted 1961
4 SASI_Rn02_00343436 predicted 1985
5 SASI_Rn02_00343437 predicted 1937
6 SASI_Rn02_00343438 predicted 1053
7 SASI_Rn02_00343439 predicted 1269
8 SASI_Rn02_00343440 predicted 1102
9 SASI_Rn02_00343441 predicted 2491
10 SASI_Rn02_00343442 predicted 1681
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380468 predicted 318
2 SASI_Rn02_00380469 predicted 388
3 SASI_Rn02_00380470 predicted 209
4 SASI_Rn02_00380471 predicted 228
5 SASI_Rn02_00380472 predicted 228
6 SASI_Rn02_00380473 predicted 232
7 SASI_Rn02_00380474 predicted 422
8 SASI_Rn02_00380475 predicted 326
9 SASI_Rn02_00380476 predicted 283
10 SASI_Rn02_00380477 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124792 predicted 1620
2 SASI_Mm01_00124794 predicted 2411
3 SASI_Mm01_00124795 predicted 2532
4 SASI_Mm01_00124796 predicted 1202
5 SASI_Mm01_00124797 predicted 263
6 SASI_Mm01_00124798 predicted 697
7 SASI_Mm01_00124799 predicted 1526
8 SASI_Mm01_00124800 predicted 212
9 SASI_Mm01_00124801 predicted 2321
10 SASI_Mm02_00334465 predicted 738
11 SASI_Mm01_00124793 predicted 603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152558
VALIDATED
IQCE MISSION shRNA Bacterial Glycerol Stock
IQ motif containing E
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152558.3-1774s21c1
Sequence:CCGGGAAGGTGTACAAGCACAAGAACTCGAGTTCTTGTGCTTGTACACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152558.3-1540s21c1
Sequence:CCGGGATTCAGACACTTACCAGCAACTCGAGTTGCTGGTAAGTGTCTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152558.3-2361s21c1
Sequence:CCGGAGAACGATGATACCTACTTAACTCGAGTTAAGTAGGTATCATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152558.3-886s21c1
Sequence:CCGGCAAACTCCAGACCGATATGAACTCGAGTTCATATCGGTCTGGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152558.3-2210s21c1
Sequence:CCGGTCCGATGATTCCGACGATATTCTCGAGAATATCGTCGGAATCATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152558.1-1932s1c1
Sequence:CCGGGATATTGTCATTGCACCGTCTCTCGAGAGACGGTGCAATGACAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152558.1-1958s1c1
Sequence:CCGGCACGAAGAACTTTCCAGTTTACTCGAGTAAACTGGAAAGTTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152558.1-593s1c1
Sequence:CCGGCAAACTCCAGACCGATATGAACTCGAGTTCATATCGGTCTGGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152558.1-1481s1c1
Sequence:CCGGGAAGGTGTACAAGCACAAGAACTCGAGTTCTTGTGCTTGTACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152558.1-691s1c1
Sequence:CCGGCAAGTTCTGAAACCACCGGAACTCGAGTTCCGGTGGTTTCAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152558.1-1247s1c1
Sequence:CCGGGATTCAGACACTTACCAGCAACTCGAGTTGCTGGTAAGTGTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152558
VALIDATED
IQCE MISSION shRNA shRNA Plasmid DNA
IQ motif containing E
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152558.3-1774s21c1
Sequence:CCGGGAAGGTGTACAAGCACAAGAACTCGAGTTCTTGTGCTTGTACACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152558.3-1540s21c1
Sequence:CCGGGATTCAGACACTTACCAGCAACTCGAGTTGCTGGTAAGTGTCTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152558.3-2361s21c1
Sequence:CCGGAGAACGATGATACCTACTTAACTCGAGTTAAGTAGGTATCATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152558.3-886s21c1
Sequence:CCGGCAAACTCCAGACCGATATGAACTCGAGTTCATATCGGTCTGGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152558.3-2210s21c1
Sequence:CCGGTCCGATGATTCCGACGATATTCTCGAGAATATCGTCGGAATCATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152558.1-1932s1c1
Sequence:CCGGGATATTGTCATTGCACCGTCTCTCGAGAGACGGTGCAATGACAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152558.1-1958s1c1
Sequence:CCGGCACGAAGAACTTTCCAGTTTACTCGAGTAAACTGGAAAGTTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152558.1-593s1c1
Sequence:CCGGCAAACTCCAGACCGATATGAACTCGAGTTCATATCGGTCTGGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152558.1-1481s1c1
Sequence:CCGGGAAGGTGTACAAGCACAAGAACTCGAGTTCTTGTGCTTGTACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152558.1-691s1c1
Sequence:CCGGCAAGTTCTGAAACCACCGGAACTCGAGTTCCGGTGGTTTCAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152558.1-1247s1c1
Sequence:CCGGGATTCAGACACTTACCAGCAACTCGAGTTGCTGGTAAGTGTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152558
VALIDATED
IQCE MISSION shRNA Lentiviral Transduction Particles
IQ motif containing E
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152558.3-1774s21c1
Sequence:CCGGGAAGGTGTACAAGCACAAGAACTCGAGTTCTTGTGCTTGTACACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152558.3-1540s21c1
Sequence:CCGGGATTCAGACACTTACCAGCAACTCGAGTTGCTGGTAAGTGTCTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275209    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152558.3-2361s21c1
Sequence:CCGGAGAACGATGATACCTACTTAACTCGAGTTAAGTAGGTATCATCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152558.3-886s21c1
Sequence:CCGGCAAACTCCAGACCGATATGAACTCGAGTTCATATCGGTCTGGAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152558.3-2210s21c1
Sequence:CCGGTCCGATGATTCCGACGATATTCTCGAGAATATCGTCGGAATCATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130906    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152558.1-1932s1c1
Sequence:CCGGGATATTGTCATTGCACCGTCTCTCGAGAGACGGTGCAATGACAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152558.1-1958s1c1
Sequence:CCGGCACGAAGAACTTTCCAGTTTACTCGAGTAAACTGGAAAGTTCTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152558.1-593s1c1
Sequence:CCGGCAAACTCCAGACCGATATGAACTCGAGTTCATATCGGTCTGGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152558.1-1481s1c1
Sequence:CCGGGAAGGTGTACAAGCACAAGAACTCGAGTTCTTGTGCTTGTACACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152558.1-691s1c1
Sequence:CCGGCAAGTTCTGAAACCACCGGAACTCGAGTTCCGGTGGTTTCAGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_152558.1-1247s1c1
Sequence:CCGGGATTCAGACACTTACCAGCAACTCGAGTTGCTGGTAAGTGTCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028833
VALIDATED
IQCE MISSION shRNA Bacterial Glycerol Stock
IQ motif containing E
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217802    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028833.3-2536s1c1
Sequence:CCGGCAAGTCAGAGGACTCTAAATCCTCGAGGATTTAGAGTCCTCTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028833.2-1278s1c1
Sequence:CCGGCCATCCAACATCTCAGTGCAACTCGAGTTGCACTGAGATGTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028833.2-2683s1c1
Sequence:CCGGCCACTTCCATTTCCCACTTTACTCGAGTAAAGTGGGAAATGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028833.2-617s1c1
Sequence:CCGGGTTGAAGAAGTCCTTACATATCTCGAGATATGTAAGGACTTCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028833.2-605s1c1
Sequence:CCGGCGAGATCATCGAGTTGAAGAACTCGAGTTCTTCAACTCGATGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028833.2-1211s1c1
Sequence:CCGGGAGTTCCTCAGAAAGCCCAAACTCGAGTTTGGGCTTTCTGAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028833
VALIDATED
IQCE MISSION shRNA shRNA Plasmid DNA
IQ motif containing E
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217802    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028833.3-2536s1c1
Sequence:CCGGCAAGTCAGAGGACTCTAAATCCTCGAGGATTTAGAGTCCTCTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028833.2-1278s1c1
Sequence:CCGGCCATCCAACATCTCAGTGCAACTCGAGTTGCACTGAGATGTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028833.2-2683s1c1
Sequence:CCGGCCACTTCCATTTCCCACTTTACTCGAGTAAAGTGGGAAATGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028833.2-617s1c1
Sequence:CCGGGTTGAAGAAGTCCTTACATATCTCGAGATATGTAAGGACTTCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028833.2-605s1c1
Sequence:CCGGCGAGATCATCGAGTTGAAGAACTCGAGTTCTTCAACTCGATGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028833.2-1211s1c1
Sequence:CCGGGAGTTCCTCAGAAAGCCCAAACTCGAGTTTGGGCTTTCTGAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028833
VALIDATED
IQCE MISSION shRNA Lentiviral Transduction Particles
IQ motif containing E
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217802    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028833.3-2536s1c1
Sequence:CCGGCAAGTCAGAGGACTCTAAATCCTCGAGGATTTAGAGTCCTCTGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028833.2-1278s1c1
Sequence:CCGGCCATCCAACATCTCAGTGCAACTCGAGTTGCACTGAGATGTTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181067    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028833.2-2683s1c1
Sequence:CCGGCCACTTCCATTTCCCACTTTACTCGAGTAAAGTGGGAAATGGAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028833.2-617s1c1
Sequence:CCGGGTTGAAGAAGTCCTTACATATCTCGAGATATGTAAGGACTTCTTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028833.2-605s1c1
Sequence:CCGGCGAGATCATCGAGTTGAAGAACTCGAGTTCTTCAACTCGATGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028833.2-1211s1c1
Sequence:CCGGGAGTTCCTCAGAAAGCCCAAACTCGAGTTTGGGCTTTCTGAGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks