EMAIL THIS PAGE TO A FRIEND

IQCK

IQ motif containing K

UniProtKB ID: Q8N0W5, B2RDU0, O43327, Q8NFF4
Gene ID:
Mouse(434232) IQ motif containing K
Rat(100909537) IQ motif containing K
Zebrafish(793880) IQ motif containing K
chicken(426993) IQ motif containing K
domestic cat(101093484) IQ motif containing K
cow(506290) IQ motif containing K
dog(479824) IQ motif containing K
sheep(101118657) IQ motif containing K
domestic guinea pig(100731336) IQ motif containing K
naked mole-rat(101705323) IQ motif containing K
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153208 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153208 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153208 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081446 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081446 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081446 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153208 Rosetta Predictions human pricing
NM_001081446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223353 predicted 845
2 SASI_Hs01_00223354 predicted 908
3 SASI_Hs01_00223355 predicted 1712
4 SASI_Hs01_00223356 predicted 1634
5 SASI_Hs01_00223357 predicted 1451
6 SASI_Hs01_00223359 predicted 1857
7 SASI_Hs01_00223360 predicted 914
8 SASI_Hs01_00223361 predicted 1853
9 SASI_Hs02_00367054 predicted 1074
10 SASI_Hs01_00223362 predicted 1659
11 SASI_Hs01_00223358 predicted 1711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298401 predicted 910
2 SASI_Mm02_00298402 predicted 921
3 SASI_Mm02_00298403 predicted 566
4 SASI_Mm02_00298404 predicted 214
5 SASI_Mm02_00298405 predicted 486
6 SASI_Mm02_00298406 predicted 204
7 SASI_Mm02_00298407 predicted 355
8 SASI_Mm02_00298408 predicted 957
9 SASI_Mm02_00298409 predicted 899
10 SASI_Mm02_00298410 predicted 385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153208
VALIDATED
IQCK MISSION shRNA Bacterial Glycerol Stock
IQ motif containing K
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153208.1-898s1c1
Sequence:CCGGCCTCCCTTTCCAGAAGGATATCTCGAGATATCCTTCTGGAAAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153208.1-1919s1c1
Sequence:CCGGGCCTTTGCAAAGATCCATATTCTCGAGAATATGGATCTTTGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_153208.1-1030s21c1
Sequence:CCGGACACCCTGTCCTCAAGATAAACTCGAGTTTATCTTGAGGACAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257446    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_153208.1-2411s21c1
Sequence:CCGGATAGTCGTTTATGGTACATATCTCGAGATATGTACCATAAACGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153208.1-978s21c1
Sequence:CCGGCTTCAGTGCAGAGCACTATTTCTCGAGAAATAGTGCTCTGCACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_153208.1-1139s21c1
Sequence:CCGGTGCTTCACCAAGCGAAGAAAGCTCGAGCTTTCTTCGCTTGGTGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_153208.1-901s21c1
Sequence:CCGGCCCTTTCCAGAAGGATATAAACTCGAGTTTATATCCTTCTGGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153208
VALIDATED
IQCK MISSION shRNA shRNA Plasmid DNA
IQ motif containing K
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153208.1-898s1c1
Sequence:CCGGCCTCCCTTTCCAGAAGGATATCTCGAGATATCCTTCTGGAAAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153208.1-1919s1c1
Sequence:CCGGGCCTTTGCAAAGATCCATATTCTCGAGAATATGGATCTTTGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_153208.1-1030s21c1
Sequence:CCGGACACCCTGTCCTCAAGATAAACTCGAGTTTATCTTGAGGACAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257446    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_153208.1-2411s21c1
Sequence:CCGGATAGTCGTTTATGGTACATATCTCGAGATATGTACCATAAACGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153208.1-978s21c1
Sequence:CCGGCTTCAGTGCAGAGCACTATTTCTCGAGAAATAGTGCTCTGCACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_153208.1-1139s21c1
Sequence:CCGGTGCTTCACCAAGCGAAGAAAGCTCGAGCTTTCTTCGCTTGGTGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_153208.1-901s21c1
Sequence:CCGGCCCTTTCCAGAAGGATATAAACTCGAGTTTATATCCTTCTGGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153208
VALIDATED
IQCK MISSION shRNA Lentiviral Transduction Particles
IQ motif containing K
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153208.1-898s1c1
Sequence:CCGGCCTCCCTTTCCAGAAGGATATCTCGAGATATCCTTCTGGAAAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167688    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153208.1-1919s1c1
Sequence:CCGGGCCTTTGCAAAGATCCATATTCTCGAGAATATGGATCTTTGCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_153208.1-1030s21c1
Sequence:CCGGACACCCTGTCCTCAAGATAAACTCGAGTTTATCTTGAGGACAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257446    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_153208.1-2411s21c1
Sequence:CCGGATAGTCGTTTATGGTACATATCTCGAGATATGTACCATAAACGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153208.1-978s21c1
Sequence:CCGGCTTCAGTGCAGAGCACTATTTCTCGAGAAATAGTGCTCTGCACTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_153208.1-1139s21c1
Sequence:CCGGTGCTTCACCAAGCGAAGAAAGCTCGAGCTTTCTTCGCTTGGTGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_153208.1-901s21c1
Sequence:CCGGCCCTTTCCAGAAGGATATAAACTCGAGTTTATATCCTTCTGGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081446
IQCK MISSION shRNA Bacterial Glycerol Stock
IQ motif containing K
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081446.1-1280s21c1
Sequence:CCGGATTACAGCAGTGCCCTATTAACTCGAGTTAATAGGGCACTGCTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081446.1-173s21c1
Sequence:CCGGATCAGATCTGCGAGGAGTATGCTCGAGCATACTCCTCGCAGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081446.1-476s21c1
Sequence:CCGGTTGAGAGGAAGAGAACCAAATCTCGAGATTTGGTTCTCTTCCTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081446.1-698s21c1
Sequence:CCGGTTCGCTGTGACCCTGAGATTCCTCGAGGAATCTCAGGGTCACAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081446.1-208s21c1
Sequence:CCGGACCTTTCCAGAAGGCTATAAACTCGAGTTTATAGCCTTCTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081446
IQCK MISSION shRNA shRNA Plasmid DNA
IQ motif containing K
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081446.1-1280s21c1
Sequence:CCGGATTACAGCAGTGCCCTATTAACTCGAGTTAATAGGGCACTGCTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081446.1-173s21c1
Sequence:CCGGATCAGATCTGCGAGGAGTATGCTCGAGCATACTCCTCGCAGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081446.1-476s21c1
Sequence:CCGGTTGAGAGGAAGAGAACCAAATCTCGAGATTTGGTTCTCTTCCTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081446.1-698s21c1
Sequence:CCGGTTCGCTGTGACCCTGAGATTCCTCGAGGAATCTCAGGGTCACAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081446.1-208s21c1
Sequence:CCGGACCTTTCCAGAAGGCTATAAACTCGAGTTTATAGCCTTCTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081446
IQCK MISSION shRNA Lentiviral Transduction Particles
IQ motif containing K
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081446.1-1280s21c1
Sequence:CCGGATTACAGCAGTGCCCTATTAACTCGAGTTAATAGGGCACTGCTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081446.1-173s21c1
Sequence:CCGGATCAGATCTGCGAGGAGTATGCTCGAGCATACTCCTCGCAGATCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081446.1-476s21c1
Sequence:CCGGTTGAGAGGAAGAGAACCAAATCTCGAGATTTGGTTCTCTTCCTCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081446.1-698s21c1
Sequence:CCGGTTCGCTGTGACCCTGAGATTCCTCGAGGAATCTCAGGGTCACAGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081446.1-208s21c1
Sequence:CCGGACCTTTCCAGAAGGCTATAAACTCGAGTTTATAGCCTTCTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks