EMAIL THIS PAGE TO A FRIEND

IQGAP1

IQ motif containing GTPase activating protein 1

Synonyms: HUMORFA01 SAR1 p195
UniProtKB ID: P46940, A7MBM3
Gene ID:
Human(8826) Summary: This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
Mouse(29875) IQ motif containing GTPase activating protein 1
Rat(361598) IQ motif containing GTPase activating protein 1
Zebrafish(100002928) IQ motif containing GTPase activating protein 1
chicken(415591) IQ motif containing GTPase activating protein 1
cow(532715) IQ motif containing GTPase activating protein 1
Horse(100068724) IQ motif containing GTPase activating protein 1
domestic cat(101087841) IQ motif containing GTPase activating protein 1
dog(479050) IQ motif containing GTPase activating protein 1
domestic guinea pig(100732321) IQ motif containing GTPase activating protein 1
naked mole-rat(101720196) IQ motif containing GTPase activating protein 1
sheep(101104610) IQ motif containing GTPase activating protein 1
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200079 Anti-IQGAP1 (C-terminal region) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody human
immunohistochemistry, immunoprecipitation, western blot pricing
SAB2501549 Anti-IQGAP1 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
HPA014055 Anti-IQGAP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, rat, mouse
immunohistochemistry, western blot pricing
SAB4200329 Anti-IQGAP1 antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody human, mouse, rat
immunohistochemistry, immunoprecipitation, western blot pricing
WH0008826M1 Monoclonal Anti-IQGAP1 antibody produced in mouse clone 2C5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PLA0225 Rabbit anti-IQGAP1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. chimpanzee, ferret, human, dog, gibbon, rhesus monkey, gorilla
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003870 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003870 Rosetta Predictions human pricing
NM_001108489 Rosetta Predictions rat pricing
NM_016721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057473 predicted 869
2 SASI_Hs01_00057475 predicted 2473
3 SASI_Hs02_00336453 predicted 4128
4 SASI_Hs01_00057476 predicted 1527
5 SASI_Hs02_00336454 predicted 1542
6 SASI_Hs01_00057477 predicted 5006
7 SASI_Hs01_00057478 predicted 501
8 SASI_Hs01_00057479 predicted 1365
9 SASI_Hs01_00057480 predicted 3564
10 SASI_Hs02_00336455 predicted 1550
11 SASI_Hs01_00057474 predicted 1963
12 SASI_Hs01_00057481 predicted 2370
13 SASI_Hs01_00057482 predicted 3227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108489 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239149 predicted 5135
2 SASI_Rn02_00239150 predicted 5339
3 SASI_Rn02_00239151 predicted 5010
4 SASI_Rn02_00239152 predicted 5450
5 SASI_Rn02_00239153 predicted 5331
6 SASI_Rn02_00239154 predicted 5552
7 SASI_Rn02_00239155 predicted 4990
8 SASI_Rn02_00239156 predicted 4984
9 SASI_Rn02_00239157 predicted 5486
10 SASI_Rn02_00239158 predicted 5034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043492 predicted 4865
2 SASI_Mm01_00043493 predicted 2509
3 SASI_Mm02_00323425 predicted 2287
4 SASI_Mm01_00043494 predicted 4098
5 SASI_Mm01_00043495 predicted 3966
6 SASI_Mm02_00323426 predicted 1537
7 SASI_Mm01_00043497 predicted 3567
8 SASI_Mm01_00043498 predicted 3212
9 SASI_Mm01_00043499 predicted 3812
10 SASI_Mm01_00043500 predicted 1357
11 SASI_Mm01_00043491 predicted 4973
12 SASI_Mm01_00043496 predicted 1042
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016721
IQGAP1 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing GTPase activating protein 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016721.2-3274s21c1
Sequence:CCGGAGGAAACCCTACGGTTATTAACTCGAGTTAATAACCGTAGGGTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016721.2-3852s21c1
Sequence:CCGGAGATGTTTCTGGGCGATAATGCTCGAGCATTATCGCCCAGAAACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016721.1-2596s1c1
Sequence:CCGGCGAGACCATATAAATGACATTCTCGAGAATGTCATTTATATGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016721.1-1627s1c1
Sequence:CCGGGCCGAGAATAATGCATTTATTCTCGAGAATAAATGCATTATTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016721.1-3666s1c1
Sequence:CCGGCCTGCTTTACTACCGATACATCTCGAGATGTATCGGTAGTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016721.1-561s1c1
Sequence:CCGGCCTCAGTTTGTACCTGTTCAACTCGAGTTGAACAGGTACAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016721
IQGAP1 MISSION shRNA shRNA Plasmid DNA
IQ motif containing GTPase activating protein 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016721.2-3274s21c1
Sequence:CCGGAGGAAACCCTACGGTTATTAACTCGAGTTAATAACCGTAGGGTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016721.2-3852s21c1
Sequence:CCGGAGATGTTTCTGGGCGATAATGCTCGAGCATTATCGCCCAGAAACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016721.1-2596s1c1
Sequence:CCGGCGAGACCATATAAATGACATTCTCGAGAATGTCATTTATATGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016721.1-1627s1c1
Sequence:CCGGGCCGAGAATAATGCATTTATTCTCGAGAATAAATGCATTATTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016721.1-3666s1c1
Sequence:CCGGCCTGCTTTACTACCGATACATCTCGAGATGTATCGGTAGTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016721.1-561s1c1
Sequence:CCGGCCTCAGTTTGTACCTGTTCAACTCGAGTTGAACAGGTACAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016721
IQGAP1 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing GTPase activating protein 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016721.2-3274s21c1
Sequence:CCGGAGGAAACCCTACGGTTATTAACTCGAGTTAATAACCGTAGGGTTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016721.2-3852s21c1
Sequence:CCGGAGATGTTTCTGGGCGATAATGCTCGAGCATTATCGCCCAGAAACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016721.1-2596s1c1
Sequence:CCGGCGAGACCATATAAATGACATTCTCGAGAATGTCATTTATATGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016721.1-1627s1c1
Sequence:CCGGGCCGAGAATAATGCATTTATTCTCGAGAATAAATGCATTATTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016721.1-3666s1c1
Sequence:CCGGCCTGCTTTACTACCGATACATCTCGAGATGTATCGGTAGTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016721.1-561s1c1
Sequence:CCGGCCTCAGTTTGTACCTGTTCAACTCGAGTTGAACAGGTACAAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003870
VALIDATED
IQGAP1 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing GTPase activating protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003870.3-864s21c1
Sequence:CCGGGCATCCACTTACCAGGATATACTCGAGTATATCCTGGTAAGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003870.3-597s21c1
Sequence:CCGGCCTCAGATTCAAGACCTATATCTCGAGATATAGGTCTTGAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003870.3-6238s21c1
Sequence:CCGGGCCCACATTGTGCCTTTATTTCTCGAGAAATAAAGGCACAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003870.3-2512s21c1
Sequence:CCGGCCCACAAAGATGAAGTTGTAACTCGAGTTACAACTTCATCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003870.3-3978s21c1
Sequence:CCGGCCAGTAATCTACATTTCCATTCTCGAGAATGGAAATGTAGATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003870.2-6211s1c1
Sequence:CCGGGCCCACATTGTGCCTTTATTTCTCGAGAAATAAAGGCACAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003870.2-2484s1c1
Sequence:CCGGCCCACAAAGATGAAGTTGTAACTCGAGTTACAACTTCATCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003870.2-836s1c1
Sequence:CCGGGCATCCACTTACCAGGATATACTCGAGTATATCCTGGTAAGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003870.2-569s1c1
Sequence:CCGGCCTCAGATTCAAGACCTATATCTCGAGATATAGGTCTTGAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003870.2-3950s1c1
Sequence:CCGGCCAGTAATCTACATTTCCATTCTCGAGAATGGAAATGTAGATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003870
VALIDATED
IQGAP1 MISSION shRNA shRNA Plasmid DNA
IQ motif containing GTPase activating protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003870.3-864s21c1
Sequence:CCGGGCATCCACTTACCAGGATATACTCGAGTATATCCTGGTAAGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003870.3-597s21c1
Sequence:CCGGCCTCAGATTCAAGACCTATATCTCGAGATATAGGTCTTGAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003870.3-6238s21c1
Sequence:CCGGGCCCACATTGTGCCTTTATTTCTCGAGAAATAAAGGCACAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003870.3-2512s21c1
Sequence:CCGGCCCACAAAGATGAAGTTGTAACTCGAGTTACAACTTCATCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003870.3-3978s21c1
Sequence:CCGGCCAGTAATCTACATTTCCATTCTCGAGAATGGAAATGTAGATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003870.2-6211s1c1
Sequence:CCGGGCCCACATTGTGCCTTTATTTCTCGAGAAATAAAGGCACAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003870.2-2484s1c1
Sequence:CCGGCCCACAAAGATGAAGTTGTAACTCGAGTTACAACTTCATCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003870.2-836s1c1
Sequence:CCGGGCATCCACTTACCAGGATATACTCGAGTATATCCTGGTAAGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003870.2-569s1c1
Sequence:CCGGCCTCAGATTCAAGACCTATATCTCGAGATATAGGTCTTGAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003870.2-3950s1c1
Sequence:CCGGCCAGTAATCTACATTTCCATTCTCGAGAATGGAAATGTAGATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003870
VALIDATED
IQGAP1 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing GTPase activating protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003870.3-864s21c1
Sequence:CCGGGCATCCACTTACCAGGATATACTCGAGTATATCCTGGTAAGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003870.3-597s21c1
Sequence:CCGGCCTCAGATTCAAGACCTATATCTCGAGATATAGGTCTTGAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298930    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003870.3-6238s21c1
Sequence:CCGGGCCCACATTGTGCCTTTATTTCTCGAGAAATAAAGGCACAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003870.3-2512s21c1
Sequence:CCGGCCCACAAAGATGAAGTTGTAACTCGAGTTACAACTTCATCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003870.3-3978s21c1
Sequence:CCGGCCAGTAATCTACATTTCCATTCTCGAGAATGGAAATGTAGATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003870.2-6211s1c1
Sequence:CCGGGCCCACATTGTGCCTTTATTTCTCGAGAAATAAAGGCACAATGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003870.2-2484s1c1
Sequence:CCGGCCCACAAAGATGAAGTTGTAACTCGAGTTACAACTTCATCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003870.2-836s1c1
Sequence:CCGGGCATCCACTTACCAGGATATACTCGAGTATATCCTGGTAAGTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003870.2-569s1c1
Sequence:CCGGCCTCAGATTCAAGACCTATATCTCGAGATATAGGTCTTGAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003870.2-3950s1c1
Sequence:CCGGCCAGTAATCTACATTTCCATTCTCGAGAATGGAAATGTAGATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks