EMAIL THIS PAGE TO A FRIEND

IQGAP2

IQ motif containing GTPase activating protein 2

UniProtKB ID: Q13576, A8K4V1, B7Z8A4
Gene ID:
Human(10788) Summary: This gene encodes a member of the IQGAP family. The protein contains three IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. [provided by RefSeq, Jul 2008]
Mouse(544963) IQ motif containing GTPase activating protein 2
Rat(100360623) IQ motif containing GTPase activating protein 2
sheep(101105506) IQ motif containing GTPase activating protein 2
domestic guinea pig(100719042) IQ motif containing GTPase activating protein 2
naked mole-rat(101707718) IQ motif containing GTPase activating protein 2
Zebrafish(563030) IQ motif containing GTPase activating protein 2
cow(782315) IQ motif containing GTPase activating protein 2
Horse(100073279) IQ motif containing GTPase activating protein 2
chicken(427211) IQ motif containing GTPase activating protein 2
dog(479177) IQ motif containing GTPase activating protein 2
domestic cat(101082373) IQ motif containing GTPase activating protein 2
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006633 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006633 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006633 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027711 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027711 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027711 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006633 Rosetta Predictions human pricing
NM_027711 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006633 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341985 predicted 2360
2 SASI_Hs02_00341986 predicted 4697
3 SASI_Hs02_00341987 predicted 879
4 SASI_Hs01_00222929 predicted 4814
5 SASI_Hs01_00222931 predicted 1438
6 SASI_Hs01_00222932 predicted 3505
7 SASI_Hs02_00341988 predicted 4064
8 SASI_Hs01_00222935 predicted 1644
9 SASI_Hs02_00341989 predicted 656
10 SASI_Hs01_00222936 predicted 3415
11 SASI_Hs01_00222927 predicted 4029
12 SASI_Hs01_00222928 predicted 4729
13 SASI_Hs01_00222930 predicted 433
14 SASI_Hs01_00222933 predicted 2627
15 SASI_Hs01_00222934 predicted 3601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027711 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332621 predicted 2548
2 SASI_Mm02_00332622 predicted 642
3 SASI_Mm02_00332623 predicted 1938
4 SASI_Mm02_00332624 predicted 1099
5 SASI_Mm02_00332625 predicted 1847
6 SASI_Mm02_00332626 predicted 2724
7 SASI_Mm02_00332627 predicted 2942
8 SASI_Mm02_00332628 predicted 4197
9 SASI_Mm02_00332629 predicted 4392
10 SASI_Mm02_00332630 predicted 362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006633
IQGAP2 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing GTPase activating protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006633.1-5575s1c1
Sequence:CCGGGCAGAGCCTTTAAGTGACTAACTCGAGTTAGTCACTTAAAGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006633.1-319s1c1
Sequence:CCGGCGGCAGAACATTGCTTATGAACTCGAGTTCATAAGCAATGTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006633.1-1246s1c1
Sequence:CCGGGCCATGTATCAGAACGAACTTCTCGAGAAGTTCGTTCTGATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006633.1-2998s1c1
Sequence:CCGGGCCTCTAATCAGCGAGAAGAACTCGAGTTCTTCTCGCTGATTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006633.1-3667s1c1
Sequence:CCGGGCCTCCAACAAGCTGTTTGAACTCGAGTTCAAACAGCTTGTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006633.2-5305s21c1
Sequence:CCGGCCCACTTGAATAACGTAATTCCTCGAGGAATTACGTTATTCAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006633.2-2625s21c1
Sequence:CCGGACTAGAGGTTGCACGATTAAGCTCGAGCTTAATCGTGCAACCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006633.2-1542s21c1
Sequence:CCGGTGATATGGTTAATGCTCAAATCTCGAGATTTGAGCATTAACCATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006633
IQGAP2 MISSION shRNA shRNA Plasmid DNA
IQ motif containing GTPase activating protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006633.1-5575s1c1
Sequence:CCGGGCAGAGCCTTTAAGTGACTAACTCGAGTTAGTCACTTAAAGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006633.1-319s1c1
Sequence:CCGGCGGCAGAACATTGCTTATGAACTCGAGTTCATAAGCAATGTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006633.1-1246s1c1
Sequence:CCGGGCCATGTATCAGAACGAACTTCTCGAGAAGTTCGTTCTGATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006633.1-2998s1c1
Sequence:CCGGGCCTCTAATCAGCGAGAAGAACTCGAGTTCTTCTCGCTGATTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006633.1-3667s1c1
Sequence:CCGGGCCTCCAACAAGCTGTTTGAACTCGAGTTCAAACAGCTTGTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006633.2-5305s21c1
Sequence:CCGGCCCACTTGAATAACGTAATTCCTCGAGGAATTACGTTATTCAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006633.2-2625s21c1
Sequence:CCGGACTAGAGGTTGCACGATTAAGCTCGAGCTTAATCGTGCAACCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006633.2-1542s21c1
Sequence:CCGGTGATATGGTTAATGCTCAAATCTCGAGATTTGAGCATTAACCATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006633
IQGAP2 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing GTPase activating protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006633.1-5575s1c1
Sequence:CCGGGCAGAGCCTTTAAGTGACTAACTCGAGTTAGTCACTTAAAGGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006633.1-319s1c1
Sequence:CCGGCGGCAGAACATTGCTTATGAACTCGAGTTCATAAGCAATGTTCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006633.1-1246s1c1
Sequence:CCGGGCCATGTATCAGAACGAACTTCTCGAGAAGTTCGTTCTGATACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006633.1-2998s1c1
Sequence:CCGGGCCTCTAATCAGCGAGAAGAACTCGAGTTCTTCTCGCTGATTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006633.1-3667s1c1
Sequence:CCGGGCCTCCAACAAGCTGTTTGAACTCGAGTTCAAACAGCTTGTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430206    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006633.2-5305s21c1
Sequence:CCGGCCCACTTGAATAACGTAATTCCTCGAGGAATTACGTTATTCAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006633.2-2625s21c1
Sequence:CCGGACTAGAGGTTGCACGATTAAGCTCGAGCTTAATCGTGCAACCTCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006633.2-1542s21c1
Sequence:CCGGTGATATGGTTAATGCTCAAATCTCGAGATTTGAGCATTAACCATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027711
VALIDATED
IQGAP2 MISSION shRNA Bacterial Glycerol Stock
IQ motif containing GTPase activating protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027711.1-495s21c1
Sequence:CCGGTGTGGAGCAGACACGTTATAACTCGAGTTATAACGTGTCTGCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027711.1-3818s21c1
Sequence:CCGGCCGTCAGCAAGCCAGTTATTTCTCGAGAAATAACTGGCTTGCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027711.1-5024s21c1
Sequence:CCGGTGATTGGAATCACGGCTTATACTCGAGTATAAGCCGTGATTCCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027711.1-2075s21c1
Sequence:CCGGCTTGGGTTCCACCCGAATTATCTCGAGATAATTCGGGTGGAACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027711.1-899s21c1
Sequence:CCGGTGGCCAAGCAGACCATTATAACTCGAGTTATAATGGTCTGCTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027711
VALIDATED
IQGAP2 MISSION shRNA shRNA Plasmid DNA
IQ motif containing GTPase activating protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027711.1-495s21c1
Sequence:CCGGTGTGGAGCAGACACGTTATAACTCGAGTTATAACGTGTCTGCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027711.1-3818s21c1
Sequence:CCGGCCGTCAGCAAGCCAGTTATTTCTCGAGAAATAACTGGCTTGCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027711.1-5024s21c1
Sequence:CCGGTGATTGGAATCACGGCTTATACTCGAGTATAAGCCGTGATTCCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027711.1-2075s21c1
Sequence:CCGGCTTGGGTTCCACCCGAATTATCTCGAGATAATTCGGGTGGAACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027711.1-899s21c1
Sequence:CCGGTGGCCAAGCAGACCATTATAACTCGAGTTATAATGGTCTGCTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027711
VALIDATED
IQGAP2 MISSION shRNA Lentiviral Transduction Particles
IQ motif containing GTPase activating protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027711.1-495s21c1
Sequence:CCGGTGTGGAGCAGACACGTTATAACTCGAGTTATAACGTGTCTGCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027711.1-3818s21c1
Sequence:CCGGCCGTCAGCAAGCCAGTTATTTCTCGAGAAATAACTGGCTTGCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027711.1-5024s21c1
Sequence:CCGGTGATTGGAATCACGGCTTATACTCGAGTATAAGCCGTGATTCCAATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027711.1-2075s21c1
Sequence:CCGGCTTGGGTTCCACCCGAATTATCTCGAGATAATTCGGGTGGAACCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027711.1-899s21c1
Sequence:CCGGTGGCCAAGCAGACCATTATAACTCGAGTTATAATGGTCTGCTTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks