EMAIL THIS PAGE TO A FRIEND

IRAK1BP1

interleukin-1 receptor-associated kinase 1 binding protein 1

Synonyms: AIP70 SIMPL
UniProtKB ID: Q5VVH5
Gene ID:
Mouse(65099) interleukin-1 receptor-associated kinase 1 binding protein 1
Rat(300862) interleukin-1 receptor-associated kinase 1 binding protein 1
domestic guinea pig(100718724) interleukin-1 receptor-associated kinase 1 binding protein 1
naked mole-rat(101699305) interleukin-1 receptor-associated kinase 1 binding protein 1
sheep(101111638) interleukin-1 receptor-associated kinase 1 binding protein 1
Zebrafish(553809) interleukin-1 receptor-associated kinase 1 binding protein 1
cow(782235) interleukin-1 receptor-associated kinase 1 binding protein 1
domestic cat(101095742) interleukin-1 receptor-associated kinase 1 binding protein 1
chicken(421857) interleukin-1 receptor-associated kinase 1 binding protein 1
dog(481892) interleukin-1 receptor-associated kinase 1 binding protein 1
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022986 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022986 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022986 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_059729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_059729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_059729 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010844 Rosetta Predictions human pricing
NM_001106843 Rosetta Predictions rat pricing
NM_022986 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00109105 predicted 359
2 SASI_Hs01_00109106 predicted 481
3 SASI_Hs01_00109107 predicted 471
4 SASI_Hs01_00109108 predicted 244
5 SASI_Hs01_00109109 predicted 225
6 SASI_Hs02_00305780 predicted 479
7 SASI_Hs02_00305781 predicted 257
8 SASI_Hs01_00109111 predicted 652
9 SASI_Hs01_00109113 predicted 730
10 SASI_Hs02_00305782 predicted 735
11 SASI_Hs01_00109110 predicted 668
12 SASI_Hs01_00109112 predicted 552
13 SASI_Hs01_00109114 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106843 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222946 predicted 538
2 SASI_Rn02_00222947 predicted 545
3 SASI_Rn02_00222948 predicted 755
4 SASI_Rn02_00222949 predicted 790
5 SASI_Rn02_00222950 predicted 865
6 SASI_Rn02_00222951 predicted 500
7 SASI_Rn02_00222952 predicted 940
8 SASI_Rn02_00222953 predicted 807
9 SASI_Rn02_00222954 predicted 634
10 SASI_Rn02_00222955 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117740 predicted 407
2 SASI_Mm01_00117741 predicted 385
3 SASI_Mm02_00326709 predicted 398
4 SASI_Mm01_00117743 predicted 503
5 SASI_Mm01_00117744 predicted 1035
6 SASI_Mm01_00117745 predicted 353
7 SASI_Mm02_00326710 predicted 282
8 SASI_Mm01_00117746 predicted 407
9 SASI_Mm01_00117747 predicted 353
10 SASI_Mm01_00117748 predicted 461
11 SASI_Mm01_00117739 predicted 424
12 SASI_Mm01_00117742 predicted 1044
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022986
VALIDATED
IRAK1BP1 MISSION shRNA Bacterial Glycerol Stock
interleukin-1 receptor-associated kinase 1 binding protein 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022986.3-893s21c1
Sequence:CCGGCAACATATTGTATGGCATATTCTCGAGAATATGCCATACAATATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022986.3-948s21c1
Sequence:CCGGCATAATGCCACAGAATATATACTCGAGTATATATTCTGTGGCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022986.3-687s21c1
Sequence:CCGGTCCAGACTGCCAGGCACATTACTCGAGTAATGTGCCTGGCAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022986.2-697s1c1
Sequence:CCGGCCAGGCACATTAACTGTACAACTCGAGTTGTACAGTTAATGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022986.2-745s1c1
Sequence:CCGGGCAGCTTCGAAGGTGTTCATTCTCGAGAATGAACACCTTCGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022986.2-404s1c1
Sequence:CCGGCCGAGGTCTGCATTACATTTACTCGAGTAAATGTAATGCAGACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022986.2-886s1c1
Sequence:CCGGCGGACATTCAACATATTGTATCTCGAGATACAATATGTTGAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022986.2-356s1c1
Sequence:CCGGCTGTGACAAAGAACATTAGAACTCGAGTTCTAATGTTCTTTGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022986
VALIDATED
IRAK1BP1 MISSION shRNA shRNA Plasmid DNA
interleukin-1 receptor-associated kinase 1 binding protein 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022986.3-893s21c1
Sequence:CCGGCAACATATTGTATGGCATATTCTCGAGAATATGCCATACAATATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022986.3-948s21c1
Sequence:CCGGCATAATGCCACAGAATATATACTCGAGTATATATTCTGTGGCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022986.3-687s21c1
Sequence:CCGGTCCAGACTGCCAGGCACATTACTCGAGTAATGTGCCTGGCAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022986.2-697s1c1
Sequence:CCGGCCAGGCACATTAACTGTACAACTCGAGTTGTACAGTTAATGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022986.2-745s1c1
Sequence:CCGGGCAGCTTCGAAGGTGTTCATTCTCGAGAATGAACACCTTCGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022986.2-404s1c1
Sequence:CCGGCCGAGGTCTGCATTACATTTACTCGAGTAAATGTAATGCAGACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022986.2-886s1c1
Sequence:CCGGCGGACATTCAACATATTGTATCTCGAGATACAATATGTTGAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022986.2-356s1c1
Sequence:CCGGCTGTGACAAAGAACATTAGAACTCGAGTTCTAATGTTCTTTGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022986
VALIDATED
IRAK1BP1 MISSION shRNA Lentiviral Transduction Particles
interleukin-1 receptor-associated kinase 1 binding protein 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022986.3-893s21c1
Sequence:CCGGCAACATATTGTATGGCATATTCTCGAGAATATGCCATACAATATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364229    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022986.3-948s21c1
Sequence:CCGGCATAATGCCACAGAATATATACTCGAGTATATATTCTGTGGCATTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022986.3-687s21c1
Sequence:CCGGTCCAGACTGCCAGGCACATTACTCGAGTAATGTGCCTGGCAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022986.2-697s1c1
Sequence:CCGGCCAGGCACATTAACTGTACAACTCGAGTTGTACAGTTAATGTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022986.2-745s1c1
Sequence:CCGGGCAGCTTCGAAGGTGTTCATTCTCGAGAATGAACACCTTCGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022986.2-404s1c1
Sequence:CCGGCCGAGGTCTGCATTACATTTACTCGAGTAAATGTAATGCAGACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088528    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022986.2-886s1c1
Sequence:CCGGCGGACATTCAACATATTGTATCTCGAGATACAATATGTTGAATGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_022986.2-356s1c1
Sequence:CCGGCTGTGACAAAGAACATTAGAACTCGAGTTCTAATGTTCTTTGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_059729
VALIDATED
IRAK1BP1 MISSION shRNA Bacterial Glycerol Stock
interleukin-1 receptor-associated kinase 1 binding protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_059729.3-685s1c1
Sequence:CCGGCCAGACTCTCAAGTTCATTAACTCGAGTTAATGAACTTGAGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_059729.3-513s1c1
Sequence:CCGGCCAGGTTCTGTTGAGAATCTTCTCGAGAAGATTCTCAACAGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059729.3-579s1c1
Sequence:CCGGGCTCAAGAAGTCTGTAACCTTCTCGAGAAGGTTACAGACTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_059729.3-467s1c1
Sequence:CCGGGCTAGATAGCTCTGTTGTCATCTCGAGATGACAACAGAGCTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059729.3-145s1c1
Sequence:CCGGTCTCCTCAACACAAGCCCAAACTCGAGTTTGGGCTTGTGTTGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_059729
VALIDATED
IRAK1BP1 MISSION shRNA shRNA Plasmid DNA
interleukin-1 receptor-associated kinase 1 binding protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_059729.3-685s1c1
Sequence:CCGGCCAGACTCTCAAGTTCATTAACTCGAGTTAATGAACTTGAGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_059729.3-513s1c1
Sequence:CCGGCCAGGTTCTGTTGAGAATCTTCTCGAGAAGATTCTCAACAGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059729.3-579s1c1
Sequence:CCGGGCTCAAGAAGTCTGTAACCTTCTCGAGAAGGTTACAGACTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_059729.3-467s1c1
Sequence:CCGGGCTAGATAGCTCTGTTGTCATCTCGAGATGACAACAGAGCTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059729.3-145s1c1
Sequence:CCGGTCTCCTCAACACAAGCCCAAACTCGAGTTTGGGCTTGTGTTGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_059729
VALIDATED
IRAK1BP1 MISSION shRNA Lentiviral Transduction Particles
interleukin-1 receptor-associated kinase 1 binding protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_059729.3-685s1c1
Sequence:CCGGCCAGACTCTCAAGTTCATTAACTCGAGTTAATGAACTTGAGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_059729.3-513s1c1
Sequence:CCGGCCAGGTTCTGTTGAGAATCTTCTCGAGAAGATTCTCAACAGAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059729.3-579s1c1
Sequence:CCGGGCTCAAGAAGTCTGTAACCTTCTCGAGAAGGTTACAGACTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_059729.3-467s1c1
Sequence:CCGGGCTAGATAGCTCTGTTGTCATCTCGAGATGACAACAGAGCTATCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059729.3-145s1c1
Sequence:CCGGTCTCCTCAACACAAGCCCAAACTCGAGTTTGGGCTTGTGTTGAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks