EMAIL THIS PAGE TO A FRIEND

IREB2

iron-responsive element binding protein 2

Synonyms: ACO3 IRP2 IRP2AD
UniProtKB ID: P48200, A8KAC7, Q13095, Q1HE21, Q59FQ7, Q9UF17
Gene ID:
Mouse(64602) iron responsive element binding protein 2
Rat(64831) iron responsive element binding protein 2
Zebrafish(652982) iron-responsive element binding protein 2
dog(475134) iron-responsive element binding protein 2
Horse(100050493) iron-responsive element binding protein 2
cow(539404) iron-responsive element binding protein 2
domestic cat(101090693) iron-responsive element binding protein 2
chicken(427490) iron-responsive element binding protein 2
sheep(101122309) iron-responsive element binding protein 2
domestic guinea pig(100730146) iron-responsive element binding protein 2
naked mole-rat(101703036) iron-responsive element binding protein 2
Gene Class: Dehydratase
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004136 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004136 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004136 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_022655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004136 Rosetta Predictions human pricing
NM_022863 Rosetta Predictions rat pricing
NM_022655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004136 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179015 predicted 520
2 SASI_Hs01_00179016 predicted 1827
3 SASI_Hs01_00179017 predicted 1882
4 SASI_Hs01_00179018 predicted 2128
5 SASI_Hs02_00336989 predicted 1684
6 SASI_Hs02_00336990 predicted 545
7 SASI_Hs01_00179019 predicted 1113
8 SASI_Hs01_00179021 predicted 1840
9 SASI_Hs01_00179022 predicted 2446
10 SASI_Hs01_00179023 predicted 1267
11 SASI_Hs01_00179020 predicted 1336
12 SASI_Hs01_00179024 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050664 predicted 2682
2 SASI_Rn01_00050665 predicted 1318
3 SASI_Rn01_00050666 predicted 2079
4 SASI_Rn01_00050667 predicted 773
5 SASI_Rn02_00263595 predicted 1063
6 SASI_Rn01_00050668 predicted 867
7 SASI_Rn01_00050670 predicted 1573
8 SASI_Rn01_00050671 predicted 1831
9 SASI_Rn01_00050672 predicted 880
10 SASI_Rn02_00263596 predicted 959
11 SASI_Rn01_00050669 predicted 313
12 SASI_Rn01_00050673 predicted 1696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168995 predicted 1676
2 SASI_Mm01_00168996 predicted 2935
3 SASI_Mm01_00168997 predicted 2553
4 SASI_Mm01_00168998 predicted 2358
5 SASI_Mm01_00168999 predicted 1045
6 SASI_Mm01_00169000 predicted 561
7 SASI_Mm01_00169001 predicted 1175
8 SASI_Mm01_00169003 predicted 1812
9 SASI_Mm01_00169004 predicted 1560
10 SASI_Mm02_00326629 predicted 550
11 SASI_Mm01_00169002 predicted 1392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004136
VALIDATED
IREB2 MISSION shRNA Bacterial Glycerol Stock
iron-responsive element binding protein 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004136.2-2513s21c1
Sequence:CCGGACGGAGCTCGAAGAGGTAATGCTCGAGCATTACCTCTTCGAGCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004136.2-2671s21c1
Sequence:CCGGGAAGGTATCCCACTGATTATTCTCGAGAATAATCAGTGGGATACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004136.2-1276s21c1
Sequence:CCGGGCAAACATGTGTCCGGAATATCTCGAGATATTCCGGACACATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004136.2-3489s21c1
Sequence:CCGGGGCCATTGGAATCTCATTTATCTCGAGATAAATGAGATTCCAATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004136.2-3234s21c1
Sequence:CCGGTATACGAATGGTGCTATTAATCTCGAGATTAATAGCACCATTCGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004136.2-3421s21c1
Sequence:CCGGTACTACTGTTTGTTGGTTTAACTCGAGTTAAACCAACAAACAGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004136.2-300s21c1
Sequence:CCGGGGAAGCTGCTGTACGAAATTGCTCGAGCAATTTCGTACAGCAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_004136.1-2326s1c1
Sequence:CCGGGCAGGAAGTATCGCTAGGAATCTCGAGATTCCTAGCGATACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004136.1-1722s1c1
Sequence:CCGGCCTCAGTTCAAGTGGAGTATTCTCGAGAATACTCCACTTGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004136.1-301s1c1
Sequence:CCGGGCCCGTGTTCTTCTTCAAGATCTCGAGATCTTGAAGAAGAACACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004136.1-1939s1c1
Sequence:CCGGCCACCCTTAGTGGTAGCTTATCTCGAGATAAGCTACCACTAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004136.1-1099s1c1
Sequence:CCGGGCTGGAAAGTTTGTTGAGTTTCTCGAGAAACTCAACAAACTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004136
VALIDATED
IREB2 MISSION shRNA shRNA Plasmid DNA
iron-responsive element binding protein 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004136.2-2513s21c1
Sequence:CCGGACGGAGCTCGAAGAGGTAATGCTCGAGCATTACCTCTTCGAGCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004136.2-2671s21c1
Sequence:CCGGGAAGGTATCCCACTGATTATTCTCGAGAATAATCAGTGGGATACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004136.2-1276s21c1
Sequence:CCGGGCAAACATGTGTCCGGAATATCTCGAGATATTCCGGACACATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004136.2-3489s21c1
Sequence:CCGGGGCCATTGGAATCTCATTTATCTCGAGATAAATGAGATTCCAATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004136.2-3234s21c1
Sequence:CCGGTATACGAATGGTGCTATTAATCTCGAGATTAATAGCACCATTCGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004136.2-3421s21c1
Sequence:CCGGTACTACTGTTTGTTGGTTTAACTCGAGTTAAACCAACAAACAGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004136.2-300s21c1
Sequence:CCGGGGAAGCTGCTGTACGAAATTGCTCGAGCAATTTCGTACAGCAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_004136.1-2326s1c1
Sequence:CCGGGCAGGAAGTATCGCTAGGAATCTCGAGATTCCTAGCGATACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004136.1-1722s1c1
Sequence:CCGGCCTCAGTTCAAGTGGAGTATTCTCGAGAATACTCCACTTGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004136.1-301s1c1
Sequence:CCGGGCCCGTGTTCTTCTTCAAGATCTCGAGATCTTGAAGAAGAACACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004136.1-1939s1c1
Sequence:CCGGCCACCCTTAGTGGTAGCTTATCTCGAGATAAGCTACCACTAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004136.1-1099s1c1
Sequence:CCGGGCTGGAAAGTTTGTTGAGTTTCTCGAGAAACTCAACAAACTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004136
VALIDATED
IREB2 MISSION shRNA Lentiviral Transduction Particles
iron-responsive element binding protein 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004136.2-2513s21c1
Sequence:CCGGACGGAGCTCGAAGAGGTAATGCTCGAGCATTACCTCTTCGAGCTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004136.2-2671s21c1
Sequence:CCGGGAAGGTATCCCACTGATTATTCTCGAGAATAATCAGTGGGATACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004136.2-1276s21c1
Sequence:CCGGGCAAACATGTGTCCGGAATATCTCGAGATATTCCGGACACATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004136.2-3489s21c1
Sequence:CCGGGGCCATTGGAATCTCATTTATCTCGAGATAAATGAGATTCCAATGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423091    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004136.2-3234s21c1
Sequence:CCGGTATACGAATGGTGCTATTAATCTCGAGATTAATAGCACCATTCGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004136.2-3421s21c1
Sequence:CCGGTACTACTGTTTGTTGGTTTAACTCGAGTTAAACCAACAAACAGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004136.2-300s21c1
Sequence:CCGGGGAAGCTGCTGTACGAAATTGCTCGAGCAATTTCGTACAGCAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_004136.1-2326s1c1
Sequence:CCGGGCAGGAAGTATCGCTAGGAATCTCGAGATTCCTAGCGATACTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004136.1-1722s1c1
Sequence:CCGGCCTCAGTTCAAGTGGAGTATTCTCGAGAATACTCCACTTGAACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_004136.1-301s1c1
Sequence:CCGGGCCCGTGTTCTTCTTCAAGATCTCGAGATCTTGAAGAAGAACACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004136.1-1939s1c1
Sequence:CCGGCCACCCTTAGTGGTAGCTTATCTCGAGATAAGCTACCACTAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004136.1-1099s1c1
Sequence:CCGGGCTGGAAAGTTTGTTGAGTTTCTCGAGAAACTCAACAAACTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022655
VALIDATED
IREB2 MISSION shRNA Bacterial Glycerol Stock
iron-responsive element binding protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022655.3-1224s21c1
Sequence:CCGGCGATAGAACTACCATAGCAAACTCGAGTTTGCTATGGTAGTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022655.3-1047s21c1
Sequence:CCGGCCTGCCAGTTACTCTTACTTTCTCGAGAAAGTAAGAGTAACTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022655.3-274s21c1
Sequence:CCGGGTACGAAATTGTGATGGCTTTCTCGAGAAAGCCATCACAATTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022655.3-241s21c1
Sequence:CCGGCCTTACTCAATACGGGTCCTACTCGAGTAGGACCCGTATTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022655.1-208s1c1
Sequence:CCGGCCTTACTCAATACGGGTCCTACTCGAGTAGGACCCGTATTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022655.1-1014s1c1
Sequence:CCGGCCTGCCAGTTACTCTTACTTTCTCGAGAAAGTAAGAGTAACTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022655.1-1191s1c1
Sequence:CCGGCGATAGAACTACCATAGCAAACTCGAGTTTGCTATGGTAGTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022655.1-3064s1c1
Sequence:CCGGGCAGATAACTTCAGTATACTTCTCGAGAAGTATACTGAAGTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022655.1-241s1c1
Sequence:CCGGGTACGAAATTGTGATGGCTTTCTCGAGAAAGCCATCACAATTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022655
VALIDATED
IREB2 MISSION shRNA shRNA Plasmid DNA
iron-responsive element binding protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022655.3-1224s21c1
Sequence:CCGGCGATAGAACTACCATAGCAAACTCGAGTTTGCTATGGTAGTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022655.3-1047s21c1
Sequence:CCGGCCTGCCAGTTACTCTTACTTTCTCGAGAAAGTAAGAGTAACTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022655.3-274s21c1
Sequence:CCGGGTACGAAATTGTGATGGCTTTCTCGAGAAAGCCATCACAATTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022655.3-241s21c1
Sequence:CCGGCCTTACTCAATACGGGTCCTACTCGAGTAGGACCCGTATTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022655.1-208s1c1
Sequence:CCGGCCTTACTCAATACGGGTCCTACTCGAGTAGGACCCGTATTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022655.1-1014s1c1
Sequence:CCGGCCTGCCAGTTACTCTTACTTTCTCGAGAAAGTAAGAGTAACTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022655.1-1191s1c1
Sequence:CCGGCGATAGAACTACCATAGCAAACTCGAGTTTGCTATGGTAGTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022655.1-3064s1c1
Sequence:CCGGGCAGATAACTTCAGTATACTTCTCGAGAAGTATACTGAAGTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022655.1-241s1c1
Sequence:CCGGGTACGAAATTGTGATGGCTTTCTCGAGAAAGCCATCACAATTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022655
VALIDATED
IREB2 MISSION shRNA Lentiviral Transduction Particles
iron-responsive element binding protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022655.3-1224s21c1
Sequence:CCGGCGATAGAACTACCATAGCAAACTCGAGTTTGCTATGGTAGTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022655.3-1047s21c1
Sequence:CCGGCCTGCCAGTTACTCTTACTTTCTCGAGAAAGTAAGAGTAACTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022655.3-274s21c1
Sequence:CCGGGTACGAAATTGTGATGGCTTTCTCGAGAAAGCCATCACAATTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022655.3-241s21c1
Sequence:CCGGCCTTACTCAATACGGGTCCTACTCGAGTAGGACCCGTATTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022655.1-208s1c1
Sequence:CCGGCCTTACTCAATACGGGTCCTACTCGAGTAGGACCCGTATTGAGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022655.1-1014s1c1
Sequence:CCGGCCTGCCAGTTACTCTTACTTTCTCGAGAAAGTAAGAGTAACTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022655.1-1191s1c1
Sequence:CCGGCGATAGAACTACCATAGCAAACTCGAGTTTGCTATGGTAGTTCTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022655.1-3064s1c1
Sequence:CCGGGCAGATAACTTCAGTATACTTCTCGAGAAGTATACTGAAGTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022655.1-241s1c1
Sequence:CCGGGTACGAAATTGTGATGGCTTTCTCGAGAAAGCCATCACAATTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks