EMAIL THIS PAGE TO A FRIEND

IRF3

interferon regulatory factor 3

UniProtKB ID: Q14653, A8K7L2, Q5FBY1, Q5FBY2, Q7Z5G6
Gene ID:
Human(3661) Summary: This gene encodes a member of the interferon regulatory transcription factor (IRF) family. The encoded protein is found in an inactive cytoplasmic form that upon serine/threonine phosphorylation forms a complex with CREBBP. This complex translocates to the nucleus and activates the transcription of interferons alpha and beta, as well as other interferon-induced genes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Mouse(54131) interferon regulatory factor 3
Rat(292892) interferon regulatory factor 3
sheep(780485) interferon regulatory factor 3
domestic guinea pig(100724910) interferon regulatory factor 3
naked mole-rat(101722762) interferon regulatory factor 3
Zebrafish(564854) interferon regulatory factor 3
domestic cat(101095934) interferon regulatory factor 3
dog(476412) interferon regulatory factor 3
cow(516979) interferon regulatory factor 3
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501565 Anti-IRF-3, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB1406043 Anti-IRF3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2107879 Anti-IRF3 antibody produced in rabbit affinity isolated antibody sheep, mouse, canine, guinea pig, horse, bovine, rabbit, human, rat, pig
western blot pricing
HPA004895 Anti-IRF3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV31992 Anti-IRF3 antibody produced in rabbit affinity isolated antibody, lyophilized powder human, mouse, rat, bovine, pig, canine
western blot pricing
AV38061 Anti-IRF3 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder human, pig
western blot pricing
SAB3500280 Anti-IRF3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501563 Anti-IRF3, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4501564 Anti-IRF3, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4503926 Anti-phospho-IRF-3 (pSer385) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301512 Anti-phospho-IRF-3 (pSer385) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB4504651 Anti-phospho-IRF-3 (pSer386) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301319 Anti-phospho-IRF-3 (pSer386) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504031 Anti-phospho-IRF-3 (pSer396) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4100036 Monoclonal Anti-IRF3 antibody produced in mouse culture supernatant human
western blot pricing
SAB4100037 Monoclonal Anti-IRF3 antibody produced in mouse culture supernatant human
western blot pricing
SAB1402824 Monoclonal Anti-IRF3 antibody produced in mouse clone 3C8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016849 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016849 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016849 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001571 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU020001 MISSION® esiRNA esiRNA human IRF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001571 Rosetta Predictions human pricing
NM_001006969 Rosetta Predictions rat pricing
NM_016849 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332144 predicted 1223
2 SASI_Hs02_00332145 predicted 781
3 SASI_Hs01_00136400 predicted 1320
4 SASI_Hs01_00136403 predicted 1113
5 SASI_Hs01_00136405 predicted 1250
6 SASI_Hs01_00136409 predicted 1022
7 SASI_Hs02_00332146 predicted 1217
8 SASI_Hs02_00332147 predicted 1370
9 SASI_Hs02_00332148 predicted 432
10 SASI_Hs02_00332149 predicted 1325
11 SASI_Hs01_00136401 predicted 501
12 SASI_Hs01_00136402 predicted 668
13 SASI_Hs01_00136404 predicted 540
14 SASI_Hs01_00136406 predicted 602
15 SASI_Hs01_00136407 predicted 566
16 SASI_Hs01_00136408 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044608 predicted 438
2 SASI_Rn01_00044609 predicted 891
3 SASI_Rn01_00044610 predicted 1199
4 SASI_Rn01_00044611 predicted 1134
5 SASI_Rn01_00044612 predicted 392
6 SASI_Rn01_00044613 predicted 1206
7 SASI_Rn01_00044615 predicted 1188
8 SASI_Rn01_00044616 predicted 241
9 SASI_Rn02_00198524 predicted 542
10 SASI_Rn01_00044617 predicted 1083
11 SASI_Rn01_00044614 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323626 predicted 720
2 SASI_Mm01_00143487 predicted 1324
3 SASI_Mm01_00143488 predicted 667
4 SASI_Mm01_00143489 predicted 549
5 SASI_Mm01_00143490 predicted 1306
6 SASI_Mm01_00143491 predicted 1573
7 SASI_Mm01_00143492 predicted 1153
8 SASI_Mm01_00143493 predicted 507
9 SASI_Mm02_00323627 predicted 1019
10 SASI_Mm02_00323628 predicted 1199
11 SASI_Mm01_00143484 predicted 1349
12 SASI_Mm01_00143485 predicted 1526
13 SASI_Mm01_00143486 predicted 1433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016849
VALIDATED
IRF3 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016849.3-1577s21c1
Sequence:CCGGGCGTCTAGGCTGGTGGTTATTCTCGAGAATAACCACCAGCCTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-676s21c1
Sequence:CCGGCGAAGTTATTTGATGGCCTGACTCGAGTCAGGCCATCAAATAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-526s21c1
Sequence:CCGGTGCGGTTAGCTGCTGACAATACTCGAGTATTGTCAGCAGCTAACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-1335s21c1
Sequence:GTACCGGGTTGTTCCTACATGTCTTAAGCTCGAGCTTAAGACATGTAGGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-1207s21c1
Sequence:CCGGCCTTCGTGGCAGATCTGATTGCTCGAGCAATCAGATCTGCCACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-391s21c1
Sequence:CCGGACGCACAGATGGCTGACTTTGCTCGAGCAAAGTCAGCCATCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016849.3-1522s21c1
Sequence:CCGGCACTCAGCTGCTACCAATAAACTCGAGTTTATTGGTAGCAGCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016849.2-646s1c1
Sequence:CCGGCCAATGTGAACAACTTCCTAACTCGAGTTAGGAAGTTGTTCACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016849.2-550s1c1
Sequence:CCGGCGAAGTTATTTGATGGCCTGACTCGAGTCAGGCCATCAAATAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016849.2-387s1c1
Sequence:CCGGCGGAAAGAAGTGTTGCGGTTACTCGAGTAACCGCAACACTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016849.2-437s1c1
Sequence:CCGGCCCTCATAAAGTGTATGAGTTCTCGAGAACTCATACACTTTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016849.2-1127s1c1
Sequence:CCGGCCCACGCTACACTCTGTGGTTCTCGAGAACCACAGAGTGTAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016849
VALIDATED
IRF3 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016849.3-1577s21c1
Sequence:CCGGGCGTCTAGGCTGGTGGTTATTCTCGAGAATAACCACCAGCCTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-676s21c1
Sequence:CCGGCGAAGTTATTTGATGGCCTGACTCGAGTCAGGCCATCAAATAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-526s21c1
Sequence:CCGGTGCGGTTAGCTGCTGACAATACTCGAGTATTGTCAGCAGCTAACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-1335s21c1
Sequence:GTACCGGGTTGTTCCTACATGTCTTAAGCTCGAGCTTAAGACATGTAGGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-1207s21c1
Sequence:CCGGCCTTCGTGGCAGATCTGATTGCTCGAGCAATCAGATCTGCCACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-391s21c1
Sequence:CCGGACGCACAGATGGCTGACTTTGCTCGAGCAAAGTCAGCCATCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016849.3-1522s21c1
Sequence:CCGGCACTCAGCTGCTACCAATAAACTCGAGTTTATTGGTAGCAGCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016849.2-646s1c1
Sequence:CCGGCCAATGTGAACAACTTCCTAACTCGAGTTAGGAAGTTGTTCACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016849.2-550s1c1
Sequence:CCGGCGAAGTTATTTGATGGCCTGACTCGAGTCAGGCCATCAAATAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016849.2-387s1c1
Sequence:CCGGCGGAAAGAAGTGTTGCGGTTACTCGAGTAACCGCAACACTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016849.2-437s1c1
Sequence:CCGGCCCTCATAAAGTGTATGAGTTCTCGAGAACTCATACACTTTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016849.2-1127s1c1
Sequence:CCGGCCCACGCTACACTCTGTGGTTCTCGAGAACCACAGAGTGTAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016849
VALIDATED
IRF3 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016849.3-1577s21c1
Sequence:CCGGGCGTCTAGGCTGGTGGTTATTCTCGAGAATAACCACCAGCCTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-676s21c1
Sequence:CCGGCGAAGTTATTTGATGGCCTGACTCGAGTCAGGCCATCAAATAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-526s21c1
Sequence:CCGGTGCGGTTAGCTGCTGACAATACTCGAGTATTGTCAGCAGCTAACCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-1335s21c1
Sequence:GTACCGGGTTGTTCCTACATGTCTTAAGCTCGAGCTTAAGACATGTAGGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-1207s21c1
Sequence:CCGGCCTTCGTGGCAGATCTGATTGCTCGAGCAATCAGATCTGCCACGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016849.3-391s21c1
Sequence:CCGGACGCACAGATGGCTGACTTTGCTCGAGCAAAGTCAGCCATCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016849.3-1522s21c1
Sequence:CCGGCACTCAGCTGCTACCAATAAACTCGAGTTTATTGGTAGCAGCTGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016849.2-646s1c1
Sequence:CCGGCCAATGTGAACAACTTCCTAACTCGAGTTAGGAAGTTGTTCACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016849.2-550s1c1
Sequence:CCGGCGAAGTTATTTGATGGCCTGACTCGAGTCAGGCCATCAAATAACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016849.2-387s1c1
Sequence:CCGGCGGAAAGAAGTGTTGCGGTTACTCGAGTAACCGCAACACTTCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016849.2-437s1c1
Sequence:CCGGCCCTCATAAAGTGTATGAGTTCTCGAGAACTCATACACTTTATGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016849.2-1127s1c1
Sequence:CCGGCCCACGCTACACTCTGTGGTTCTCGAGAACCACAGAGTGTAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001571
IRF3 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001571.4-472s21c1
Sequence:CCGGGCCAACCTGGAAGAGGAATTTCTCGAGAAATTCCTCTTCCAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001571.4-509s21c1
Sequence:CCGGCGCAAAGAAGGGTTGCGTTTACTCGAGTAAACGCAACCCTTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001571.1-1016s1c1
Sequence:CCGGCCCTTCATTGTAGATCTGATTCTCGAGAATCAGATCTACAATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001571.1-302s1c1
Sequence:CCGGCGCAAAGAAGGGTTGCGTTTACTCGAGTAAACGCAACCCTTCTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001571.1-187s1c1
Sequence:CCGGGCAGGAGGATTTCGGAATCTTCTCGAGAAGATTCCGAAATCCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001571.1-265s1c1
Sequence:CCGGGCCAACCTGGAAGAGGAATTTCTCGAGAAATTCCTCTTCCAGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001571
IRF3 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001571.4-472s21c1
Sequence:CCGGGCCAACCTGGAAGAGGAATTTCTCGAGAAATTCCTCTTCCAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001571.4-509s21c1
Sequence:CCGGCGCAAAGAAGGGTTGCGTTTACTCGAGTAAACGCAACCCTTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001571.1-1016s1c1
Sequence:CCGGCCCTTCATTGTAGATCTGATTCTCGAGAATCAGATCTACAATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001571.1-302s1c1
Sequence:CCGGCGCAAAGAAGGGTTGCGTTTACTCGAGTAAACGCAACCCTTCTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001571.1-187s1c1
Sequence:CCGGGCAGGAGGATTTCGGAATCTTCTCGAGAAGATTCCGAAATCCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001571.1-265s1c1
Sequence:CCGGGCCAACCTGGAAGAGGAATTTCTCGAGAAATTCCTCTTCCAGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001571
IRF3 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001571.4-472s21c1
Sequence:CCGGGCCAACCTGGAAGAGGAATTTCTCGAGAAATTCCTCTTCCAGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001571.4-509s21c1
Sequence:CCGGCGCAAAGAAGGGTTGCGTTTACTCGAGTAAACGCAACCCTTCTTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001571.1-1016s1c1
Sequence:CCGGCCCTTCATTGTAGATCTGATTCTCGAGAATCAGATCTACAATGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001571.1-302s1c1
Sequence:CCGGCGCAAAGAAGGGTTGCGTTTACTCGAGTAAACGCAACCCTTCTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001571.1-187s1c1
Sequence:CCGGGCAGGAGGATTTCGGAATCTTCTCGAGAAGATTCCGAAATCCTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001571.1-265s1c1
Sequence:CCGGGCCAACCTGGAAGAGGAATTTCTCGAGAAATTCCTCTTCCAGGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks