EMAIL THIS PAGE TO A FRIEND

IRF7

interferon regulatory factor 7

Synonyms: IRF-7H IRF7A IRF7B IRF7C IRF7H
Gene ID:
Human(3665) Summary: IRF7 encodes interferon regulatory factor 7, a member of the interferon regulatory transcription factor (IRF) family. IRF7 has been shown to play a role in the transcriptional activation of virus-inducible cellular genes, including interferon beta chain genes. Inducible expression of IRF7 is largely restricted to lymphoid tissue. Multiple IRF7 transcript variants have been identified, although the functional consequences of these have not yet been established. [provided by RefSeq, Jul 2008]
Mouse(54123) interferon regulatory factor 7
Rat(293624) interferon regulatory factor 7
sheep(101103683) interferon regulatory factor 7
domestic guinea pig(101788200) interferon regulatory factor 7
naked mole-rat(101710824) interferon regulatory factor 7
Zebrafish(393650) interferon regulatory factor 7
cow(100125591) interferon regulatory factor 7
domestic cat(101084060) interferon regulatory factor 7
dog(483406) interferon regulatory factor 7
chicken(396330) interferon regulatory factor 7
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100116 Anti-IRF7 (106-120) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100117 Anti-IRF7 (316-330) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
PRS3941 Anti-IRF7 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2900274 Anti-IRF7 (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
PRS3943 Anti-IRF7 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB2900386 Anti-IRF7 (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunohistochemistry, western blot pricing
SAB2108162 Anti-IRF7 antibody produced in rabbit affinity isolated antibody bovine, horse, rat, mouse, human, rabbit, pig
western blot pricing
SAB2101180 Anti-IRF7 antibody produced in rabbit affinity isolated antibody, lyophilized powder pig, rat, horse, mouse, human, bovine, rabbit
western blot pricing
HPA052757 Anti-IRF7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2104662 Anti-IRF7 antibody produced in rabbit affinity isolated antibody bovine, rabbit, canine, rat, mouse, human, pig, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001572 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001572 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001572 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016850 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016850 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016850 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001572 Rosetta Predictions human pricing
NM_004029 Rosetta Predictions human pricing
NM_004031 Rosetta Predictions human pricing
NM_001033691 Rosetta Predictions rat pricing
NM_016850 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001572 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108935 predicted 715
2 SASI_Hs01_00108936 predicted 674
3 SASI_Hs01_00108937 predicted 678
4 SASI_Hs01_00108938 predicted 1641
5 SASI_Hs01_00108939 predicted 1592
6 SASI_Hs01_00108940 predicted 682
7 SASI_Hs01_00108941 predicted 715
8 SASI_Hs01_00108942 predicted 833
9 SASI_Hs01_00108943 predicted 1867
10 SASI_Hs01_00108944 predicted 1826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221272 predicted 714
2 SASI_Hs01_00221273 predicted 675
3 SASI_Hs01_00221274 predicted 680
4 SASI_Hs01_00221275 predicted 1559
5 SASI_Hs01_00221276 predicted 1500
6 SASI_Hs01_00221277 predicted 681
7 SASI_Hs01_00221278 predicted 720
8 SASI_Hs01_00221279 predicted 837
9 SASI_Hs01_00221280 predicted 1786
10 SASI_Hs01_00221281 predicted 1736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153315 predicted 792
2 SASI_Hs01_00153316 predicted 756
3 SASI_Hs01_00153317 predicted 760
4 SASI_Hs01_00153318 predicted 1716
5 SASI_Hs01_00153319 predicted 1663
6 SASI_Hs01_00153320 predicted 759
7 SASI_Hs01_00153321 predicted 797
8 SASI_Hs01_00153322 predicted 913
9 SASI_Hs01_00153323 predicted 1949
10 SASI_Hs01_00153324 predicted 1904
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038489 predicted 530
2 SASI_Rn01_00038490 predicted 745
3 SASI_Rn01_00038491 predicted 560
4 SASI_Rn01_00038492 predicted 693
5 SASI_Rn01_00038493 predicted 950
6 SASI_Rn01_00038494 predicted 1520
7 SASI_Rn01_00038495 predicted 839
8 SASI_Rn01_00038496 predicted 1356
9 SASI_Rn01_00038497 predicted 503
10 SASI_Rn01_00038498 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016850 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188289 predicted 975
2 SASI_Mm01_00188290 predicted 1315
3 SASI_Mm01_00188291 predicted 676
4 SASI_Mm01_00188292 predicted 1552
5 SASI_Mm01_00188293 predicted 442
6 SASI_Mm01_00188294 predicted 1383
7 SASI_Mm01_00188295 predicted 1415
8 SASI_Mm01_00188296 predicted 1372
9 SASI_Mm01_00188297 predicted 1276
10 SASI_Mm01_00188298 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001572
VALIDATED
IRF7 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-683s21c1
Sequence:CCGGTTCGTGATGCTGCGGGATAACCTCGAGGTTATCCCGCAGCATCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-951s21c1
Sequence:CCGGACCATCTGCTGACAGCGTCATCTCGAGATGACGCTGTCAGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-1292s21c1
Sequence:CCGGCCGAGCTGCACGTTCCTATACCTCGAGGTATAGGAACGTGCAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-1645s21c1
Sequence:CCGGCCCACGCTATACCATCTACCTCTCGAGAGGTAGATGGTATAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-1234s21c1
Sequence:CCGGGCTGGACGTGACCATCATGTACTCGAGTACATGATGGTCACGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001572.2-1213s1c1
Sequence:CCGGCCCGAGCTGCACGTTCCTATACTCGAGTATAGGAACGTGCAGCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001572.2-1573s1c1
Sequence:CCGGCTATACCATCTACCTGGGCTTCTCGAGAAGCCCAGGTAGATGGTATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001572.2-329s1c1
Sequence:CCGGCTGTTCGGAGAGTGGCTCCTTCTCGAGAAGGAGCCACTCTCCGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001572.2-1686s1c1
Sequence:CCGGCGCAGCGTGAGGGTGTGTCTTCTCGAGAAGACACACCCTCACGCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_001572.2-1156s1c1
Sequence:CCGGGCTGGACGTGACCATCATGTACTCGAGTACATGATGGTCACGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001572
VALIDATED
IRF7 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-683s21c1
Sequence:CCGGTTCGTGATGCTGCGGGATAACCTCGAGGTTATCCCGCAGCATCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-951s21c1
Sequence:CCGGACCATCTGCTGACAGCGTCATCTCGAGATGACGCTGTCAGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-1292s21c1
Sequence:CCGGCCGAGCTGCACGTTCCTATACCTCGAGGTATAGGAACGTGCAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-1645s21c1
Sequence:CCGGCCCACGCTATACCATCTACCTCTCGAGAGGTAGATGGTATAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-1234s21c1
Sequence:CCGGGCTGGACGTGACCATCATGTACTCGAGTACATGATGGTCACGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001572.2-1213s1c1
Sequence:CCGGCCCGAGCTGCACGTTCCTATACTCGAGTATAGGAACGTGCAGCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001572.2-1573s1c1
Sequence:CCGGCTATACCATCTACCTGGGCTTCTCGAGAAGCCCAGGTAGATGGTATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001572.2-329s1c1
Sequence:CCGGCTGTTCGGAGAGTGGCTCCTTCTCGAGAAGGAGCCACTCTCCGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001572.2-1686s1c1
Sequence:CCGGCGCAGCGTGAGGGTGTGTCTTCTCGAGAAGACACACCCTCACGCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_001572.2-1156s1c1
Sequence:CCGGGCTGGACGTGACCATCATGTACTCGAGTACATGATGGTCACGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001572
VALIDATED
IRF7 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-683s21c1
Sequence:CCGGTTCGTGATGCTGCGGGATAACCTCGAGGTTATCCCGCAGCATCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-951s21c1
Sequence:CCGGACCATCTGCTGACAGCGTCATCTCGAGATGACGCTGTCAGCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-1292s21c1
Sequence:CCGGCCGAGCTGCACGTTCCTATACCTCGAGGTATAGGAACGTGCAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-1645s21c1
Sequence:CCGGCCCACGCTATACCATCTACCTCTCGAGAGGTAGATGGTATAGCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001572.3-1234s21c1
Sequence:CCGGGCTGGACGTGACCATCATGTACTCGAGTACATGATGGTCACGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001572.2-1213s1c1
Sequence:CCGGCCCGAGCTGCACGTTCCTATACTCGAGTATAGGAACGTGCAGCTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001572.2-1573s1c1
Sequence:CCGGCTATACCATCTACCTGGGCTTCTCGAGAAGCCCAGGTAGATGGTATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001572.2-329s1c1
Sequence:CCGGCTGTTCGGAGAGTGGCTCCTTCTCGAGAAGGAGCCACTCTCCGAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001572.2-1686s1c1
Sequence:CCGGCGCAGCGTGAGGGTGTGTCTTCTCGAGAAGACACACCCTCACGCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_001572.2-1156s1c1
Sequence:CCGGGCTGGACGTGACCATCATGTACTCGAGTACATGATGGTCACGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016850
VALIDATED
IRF7 MISSION shRNA Bacterial Glycerol Stock
interferon regulatory factor 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-760s21c1
Sequence:CCGGGATCCAGTTGATCCGCATAAGCTCGAGCTTATGCGGATCAACTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-734s21c1
Sequence:CCGGTTATCTTGCGCCAAGACAATTCTCGAGAATTGTCTTGGCGCAAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-1038s21c1
Sequence:CCGGCCAGGAGCAAGACCGTGTTTACTCGAGTAAACACGGTCTTGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-621s21c1
Sequence:CCGGGTGGCCACCTAGTGGAGTTAACTCGAGTTAACTCCACTAGGTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-450s21c1
Sequence:CCGGGCTGTTTGGAGACTGGCTATTCTCGAGAATAGCCAGTCTCCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016850.1-883s1c1
Sequence:CCGGCCAGGATCATTTCTGGCAAGACTCGAGTCTTGCCAGAAATGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016850.1-772s1c1
Sequence:CCGGCCGCATAAGGTGTACGAACTTCTCGAGAAGTTCGTACACCTTATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016850.1-1494s1c1
Sequence:CCGGCTTCGACTTCAGCACTTTCTTCTCGAGAAGAAAGTGCTGAAGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016850.1-1554s1c1
Sequence:CCGGGTCACCACACTACACCATCTACTCGAGTAGATGGTGTAGTGTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016850.1-542s1c1
Sequence:CCGGCCTGGAAGCATTTCGGTCGTACTCGAGTACGACCGAAATGCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016850
VALIDATED
IRF7 MISSION shRNA shRNA Plasmid DNA
interferon regulatory factor 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-760s21c1
Sequence:CCGGGATCCAGTTGATCCGCATAAGCTCGAGCTTATGCGGATCAACTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-734s21c1
Sequence:CCGGTTATCTTGCGCCAAGACAATTCTCGAGAATTGTCTTGGCGCAAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-1038s21c1
Sequence:CCGGCCAGGAGCAAGACCGTGTTTACTCGAGTAAACACGGTCTTGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-621s21c1
Sequence:CCGGGTGGCCACCTAGTGGAGTTAACTCGAGTTAACTCCACTAGGTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-450s21c1
Sequence:CCGGGCTGTTTGGAGACTGGCTATTCTCGAGAATAGCCAGTCTCCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016850.1-883s1c1
Sequence:CCGGCCAGGATCATTTCTGGCAAGACTCGAGTCTTGCCAGAAATGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016850.1-772s1c1
Sequence:CCGGCCGCATAAGGTGTACGAACTTCTCGAGAAGTTCGTACACCTTATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016850.1-1494s1c1
Sequence:CCGGCTTCGACTTCAGCACTTTCTTCTCGAGAAGAAAGTGCTGAAGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016850.1-1554s1c1
Sequence:CCGGGTCACCACACTACACCATCTACTCGAGTAGATGGTGTAGTGTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016850.1-542s1c1
Sequence:CCGGCCTGGAAGCATTTCGGTCGTACTCGAGTACGACCGAAATGCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016850
VALIDATED
IRF7 MISSION shRNA Lentiviral Transduction Particles
interferon regulatory factor 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-760s21c1
Sequence:CCGGGATCCAGTTGATCCGCATAAGCTCGAGCTTATGCGGATCAACTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-734s21c1
Sequence:CCGGTTATCTTGCGCCAAGACAATTCTCGAGAATTGTCTTGGCGCAAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-1038s21c1
Sequence:CCGGCCAGGAGCAAGACCGTGTTTACTCGAGTAAACACGGTCTTGCTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-621s21c1
Sequence:CCGGGTGGCCACCTAGTGGAGTTAACTCGAGTTAACTCCACTAGGTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016850.2-450s21c1
Sequence:CCGGGCTGTTTGGAGACTGGCTATTCTCGAGAATAGCCAGTCTCCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016850.1-883s1c1
Sequence:CCGGCCAGGATCATTTCTGGCAAGACTCGAGTCTTGCCAGAAATGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016850.1-772s1c1
Sequence:CCGGCCGCATAAGGTGTACGAACTTCTCGAGAAGTTCGTACACCTTATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016850.1-1494s1c1
Sequence:CCGGCTTCGACTTCAGCACTTTCTTCTCGAGAAGAAAGTGCTGAAGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_016850.1-1554s1c1
Sequence:CCGGGTCACCACACTACACCATCTACTCGAGTAGATGGTGTAGTGTGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016850.1-542s1c1
Sequence:CCGGCCTGGAAGCATTTCGGTCGTACTCGAGTACGACCGAAATGCTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks