EMAIL THIS PAGE TO A FRIEND

IRGC

immunity-related GTPase family, cinema

Synonyms: CINEMA IFGGE IRGC1 Iigp5 R30953_1
UniProtKB ID: Q6NXR0, Q05BR8
Gene ID:
Rat(308428) immunity-related GTPase family, cinema
cow(539080) immunity-related GTPase family, cinema
dog(476445) immunity-related GTPase family, cinema
domestic guinea pig(100729232) immunity-related GTPase family, cinema
naked mole-rat(101707237) immunity-related GTPase family, cinema
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019612 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024061 MISSION® esiRNA esiRNA human IRGC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019612 Rosetta Predictions human pricing
NM_001014016 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114172 predicted 504
2 SASI_Hs01_00114173 predicted 506
3 SASI_Hs01_00114174 predicted 1134
4 SASI_Hs01_00114175 predicted 1123
5 SASI_Hs01_00114176 predicted 374
6 SASI_Hs01_00114177 predicted 1279
7 SASI_Hs01_00114178 predicted 1089
8 SASI_Hs01_00114179 predicted 598
9 SASI_Hs01_00114180 predicted 614
10 SASI_Hs01_00114181 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014016 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111916 predicted 1006
2 SASI_Rn02_00201395 predicted 582
3 SASI_Rn01_00111917 predicted 610
4 SASI_Rn01_00111918 predicted 269
5 SASI_Rn01_00111919 predicted 1226
6 SASI_Rn01_00111920 predicted 1255
7 SASI_Rn01_00111922 predicted 1082
8 SASI_Rn02_00201396 predicted 850
9 SASI_Rn01_00111923 predicted 460
10 SASI_Rn01_00111924 predicted 1034
11 SASI_Rn01_00111921 predicted 1133
12 SASI_Rn01_00111925 predicted 1003
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019612
IRGC MISSION shRNA Bacterial Glycerol Stock
immunity-related GTPase family, cinema
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019612.3-530s21c1
Sequence:CCGGAGGTAGACTTCAGCCGCTATGCTCGAGCATAGCGGCTGAAGTCTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019612.3-1473s21c1
Sequence:CCGGGAAGCTCGGCCTCCTTCTTAACTCGAGTTAAGAAGGAGGCCGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-597s1c1
Sequence:CCGGCCAGGGCAAGAAGTTCTACTTCTCGAGAAGTAGAACTTCTTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-1376s1c1
Sequence:CCGGCCAGTGACAATGGCGTGGAAACTCGAGTTTCCACGCCATTGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-987s1c1
Sequence:CCGGCTACGATGATGCGTTGCTCATCTCGAGATGAGCAACGCATCATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-483s1c1
Sequence:CCGGCCCGGCTGACAAGTACCTAAACTCGAGTTTAGGTACTTGTCAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-170s1c1
Sequence:CCGGCCATCCTTATGGCCAAGGAAACTCGAGTTTCCTTGGCCATAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019612
IRGC MISSION shRNA shRNA Plasmid DNA
immunity-related GTPase family, cinema
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019612.3-530s21c1
Sequence:CCGGAGGTAGACTTCAGCCGCTATGCTCGAGCATAGCGGCTGAAGTCTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019612.3-1473s21c1
Sequence:CCGGGAAGCTCGGCCTCCTTCTTAACTCGAGTTAAGAAGGAGGCCGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-597s1c1
Sequence:CCGGCCAGGGCAAGAAGTTCTACTTCTCGAGAAGTAGAACTTCTTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-1376s1c1
Sequence:CCGGCCAGTGACAATGGCGTGGAAACTCGAGTTTCCACGCCATTGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-987s1c1
Sequence:CCGGCTACGATGATGCGTTGCTCATCTCGAGATGAGCAACGCATCATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-483s1c1
Sequence:CCGGCCCGGCTGACAAGTACCTAAACTCGAGTTTAGGTACTTGTCAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-170s1c1
Sequence:CCGGCCATCCTTATGGCCAAGGAAACTCGAGTTTCCTTGGCCATAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019612
IRGC MISSION shRNA Lentiviral Transduction Particles
immunity-related GTPase family, cinema
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019612.3-530s21c1
Sequence:CCGGAGGTAGACTTCAGCCGCTATGCTCGAGCATAGCGGCTGAAGTCTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019612.3-1473s21c1
Sequence:CCGGGAAGCTCGGCCTCCTTCTTAACTCGAGTTAAGAAGGAGGCCGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-597s1c1
Sequence:CCGGCCAGGGCAAGAAGTTCTACTTCTCGAGAAGTAGAACTTCTTGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-1376s1c1
Sequence:CCGGCCAGTGACAATGGCGTGGAAACTCGAGTTTCCACGCCATTGTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-987s1c1
Sequence:CCGGCTACGATGATGCGTTGCTCATCTCGAGATGAGCAACGCATCATCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-483s1c1
Sequence:CCGGCCCGGCTGACAAGTACCTAAACTCGAGTTTAGGTACTTGTCAGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019612.2-170s1c1
Sequence:CCGGCCATCCTTATGGCCAAGGAAACTCGAGTTTCCTTGGCCATAAGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks