EMAIL THIS PAGE TO A FRIEND

IRX5

iroquois homeobox 5

Synonyms: HMMS IRX-2a IRXB2
UniProtKB ID: P78411, H0YMS7, P78416, Q7Z2E1
Gene ID:
Human(10265) Summary: This gene encodes a member of the iroquois homeobox gene family, which are involved in several embryonic developmental processes. Knockout mice lacking this gene show that it is required for retinal cone bipolar cell differentiation, and that it negatively regulates potassium channel gene expression in the heart to ensure coordinated cardiac repolarization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
Mouse(54352) Iroquois related homeobox 5 (Drosophila)
Rat(498918) iroquois homeobox 5
chicken(770775) iroquois homeobox 5
domestic cat(101100102) iroquois homeobox 5
cow(532896) iroquois homeobox 5
dog(487276) iroquois homeobox 5
domestic guinea pig(100718252) iroquois homeobox 5
naked mole-rat(101698088) iroquois homeobox 5
sheep(101118378) iroquois homeobox 5
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005853 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005853 Rosetta Predictions human pricing
NM_001030044 Rosetta Predictions rat pricing
NM_018826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184223 predicted 1217
2 SASI_Hs01_00184224 predicted 1179
3 SASI_Hs01_00184225 predicted 1219
4 SASI_Hs01_00184226 predicted 1187
5 SASI_Hs01_00184227 predicted 1142
6 SASI_Hs01_00184228 predicted 1210
7 SASI_Hs01_00184229 predicted 1182
8 SASI_Hs01_00184230 predicted 1245
9 SASI_Hs01_00184231 predicted 1181
10 SASI_Hs01_00184232 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030044 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058498 predicted 562
2 SASI_Rn02_00203554 predicted 600
3 SASI_Rn01_00058501 predicted 379
4 SASI_Rn02_00203555 predicted 565
5 SASI_Rn02_00203556 predicted 601
6 SASI_Rn01_00058504 predicted 1090
7 SASI_Rn01_00058505 predicted 372
8 SASI_Rn01_00058506 predicted 236
9 SASI_Rn02_00203557 predicted 994
10 SASI_Rn02_00203558 predicted 340
11 SASI_Rn01_00058499 predicted 419
12 SASI_Rn01_00058500 predicted 479
13 SASI_Rn01_00058502 predicted 401
14 SASI_Rn01_00058503 predicted 410
15 SASI_Rn01_00058507 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078515 predicted 744
2 SASI_Mm01_00078516 predicted 727
3 SASI_Mm01_00078517 predicted 1226
4 SASI_Mm01_00078518 predicted 1365
5 SASI_Mm01_00078519 predicted 1717
6 SASI_Mm01_00078520 predicted 447
7 SASI_Mm01_00078521 predicted 1722
8 SASI_Mm01_00078522 predicted 663
9 SASI_Mm01_00078523 predicted 663
10 SASI_Mm01_00078524 predicted 1779
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018826
VALIDATED
IRX5 MISSION shRNA Bacterial Glycerol Stock
iroquois homeobox 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018826.2-452s1c1
Sequence:CCGGGCATACAGCACCAGCGTCATTCTCGAGAATGACGCTGGTGCTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018826.2-1624s1c1
Sequence:CCGGCTACACGAACTATGGCTCCTTCTCGAGAAGGAGCCATAGTTCGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018826.2-1810s1c1
Sequence:CCGGCTATGAGTTGAAGAAAGGTATCTCGAGATACCTTTCTTCAACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018826.2-1698s1c1
Sequence:CCGGGCTCTCATTTCAATGGATTAACTCGAGTTAATCCATTGAAATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018826.2-671s1c1
Sequence:CCGGTCCTTGGGATATCACCCTTATCTCGAGATAAGGGTGATATCCCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018826.2-453s21c1
Sequence:CCGGCATACAGCACCAGCGTCATTTCTCGAGAAATGACGCTGGTGCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018826.2-1617s21c1
Sequence:CCGGATCCGGGCTACACGAACTATGCTCGAGCATAGTTCGTGTAGCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018826.2-672s21c1
Sequence:CCGGCCTTGGGATATCACCCTTATGCTCGAGCATAAGGGTGATATCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018826.2-1884s21c1
Sequence:CCGGCCATGGCCTTGGCAGTTATTTCTCGAGAAATAACTGCCAAGGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018826.2-1810s21c1
Sequence:CCGGCTATGAGTTGAAGAAAGGTATCTCGAGATACCTTTCTTCAACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018826
VALIDATED
IRX5 MISSION shRNA shRNA Plasmid DNA
iroquois homeobox 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018826.2-452s1c1
Sequence:CCGGGCATACAGCACCAGCGTCATTCTCGAGAATGACGCTGGTGCTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018826.2-1624s1c1
Sequence:CCGGCTACACGAACTATGGCTCCTTCTCGAGAAGGAGCCATAGTTCGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018826.2-1810s1c1
Sequence:CCGGCTATGAGTTGAAGAAAGGTATCTCGAGATACCTTTCTTCAACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018826.2-1698s1c1
Sequence:CCGGGCTCTCATTTCAATGGATTAACTCGAGTTAATCCATTGAAATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018826.2-671s1c1
Sequence:CCGGTCCTTGGGATATCACCCTTATCTCGAGATAAGGGTGATATCCCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018826.2-453s21c1
Sequence:CCGGCATACAGCACCAGCGTCATTTCTCGAGAAATGACGCTGGTGCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018826.2-1617s21c1
Sequence:CCGGATCCGGGCTACACGAACTATGCTCGAGCATAGTTCGTGTAGCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018826.2-672s21c1
Sequence:CCGGCCTTGGGATATCACCCTTATGCTCGAGCATAAGGGTGATATCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018826.2-1884s21c1
Sequence:CCGGCCATGGCCTTGGCAGTTATTTCTCGAGAAATAACTGCCAAGGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018826.2-1810s21c1
Sequence:CCGGCTATGAGTTGAAGAAAGGTATCTCGAGATACCTTTCTTCAACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018826
VALIDATED
IRX5 MISSION shRNA Lentiviral Transduction Particles
iroquois homeobox 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018826.2-452s1c1
Sequence:CCGGGCATACAGCACCAGCGTCATTCTCGAGAATGACGCTGGTGCTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018826.2-1624s1c1
Sequence:CCGGCTACACGAACTATGGCTCCTTCTCGAGAAGGAGCCATAGTTCGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018826.2-1810s1c1
Sequence:CCGGCTATGAGTTGAAGAAAGGTATCTCGAGATACCTTTCTTCAACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018826.2-1698s1c1
Sequence:CCGGGCTCTCATTTCAATGGATTAACTCGAGTTAATCCATTGAAATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018826.2-671s1c1
Sequence:CCGGTCCTTGGGATATCACCCTTATCTCGAGATAAGGGTGATATCCCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018826.2-453s21c1
Sequence:CCGGCATACAGCACCAGCGTCATTTCTCGAGAAATGACGCTGGTGCTGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018826.2-1617s21c1
Sequence:CCGGATCCGGGCTACACGAACTATGCTCGAGCATAGTTCGTGTAGCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018826.2-672s21c1
Sequence:CCGGCCTTGGGATATCACCCTTATGCTCGAGCATAAGGGTGATATCCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018826.2-1884s21c1
Sequence:CCGGCCATGGCCTTGGCAGTTATTTCTCGAGAAATAACTGCCAAGGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018826.2-1810s21c1
Sequence:CCGGCTATGAGTTGAAGAAAGGTATCTCGAGATACCTTTCTTCAACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005853
VALIDATED
IRX5 MISSION shRNA Bacterial Glycerol Stock
iroquois homeobox 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005853.3-1556s1c1
Sequence:CCGGCCTCCTATTCAGAAGTTTATACTCGAGTATAAACTTCTGAATAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005853.3-1428s1c1
Sequence:CCGGGAAAGGTATGTCCGACATTTACTCGAGTAAATGTCGGACATACCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005853.3-996s1c1
Sequence:CCGGACTGTGGTCTTTGGCAGAGATCTCGAGATCTCTGCCAAAGACCACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005853.3-1403s1c1
Sequence:CCGGGCAAAGACTCTCCCTATGAATCTCGAGATTCATAGGGAGAGTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005853.3-508s1c1
Sequence:CCGGCGCCTCAAGAAAGAGAATAAACTCGAGTTTATTCTCTTTCTTGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005853.5-65s21c1
Sequence:CCGGCGTACAGCACCAGCGTCATTTCTCGAGAAATGACGCTGGTGCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005853.5-1308s21c1
Sequence:CCGGGTCTCATTTCAATGGATTAAACTCGAGTTTAATCCATTGAAATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005853.5-1430s21c1
Sequence:GTACCGGAGAAAGGTATGTCCGACATTTCTCGAGAAATGTCGGACATACCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005853.5-1494s21c1
Sequence:CCGGACATGGCCTTGGCAGTTATTTCTCGAGAAATAACTGCCAAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005853.5-1226s21c1
Sequence:CCGGATCCCGGCTACACGAACTATGCTCGAGCATAGTTCGTGTAGCCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005853
VALIDATED
IRX5 MISSION shRNA shRNA Plasmid DNA
iroquois homeobox 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005853.3-1556s1c1
Sequence:CCGGCCTCCTATTCAGAAGTTTATACTCGAGTATAAACTTCTGAATAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005853.3-1428s1c1
Sequence:CCGGGAAAGGTATGTCCGACATTTACTCGAGTAAATGTCGGACATACCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005853.3-996s1c1
Sequence:CCGGACTGTGGTCTTTGGCAGAGATCTCGAGATCTCTGCCAAAGACCACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005853.3-1403s1c1
Sequence:CCGGGCAAAGACTCTCCCTATGAATCTCGAGATTCATAGGGAGAGTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005853.3-508s1c1
Sequence:CCGGCGCCTCAAGAAAGAGAATAAACTCGAGTTTATTCTCTTTCTTGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005853.5-65s21c1
Sequence:CCGGCGTACAGCACCAGCGTCATTTCTCGAGAAATGACGCTGGTGCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005853.5-1308s21c1
Sequence:CCGGGTCTCATTTCAATGGATTAAACTCGAGTTTAATCCATTGAAATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005853.5-1430s21c1
Sequence:GTACCGGAGAAAGGTATGTCCGACATTTCTCGAGAAATGTCGGACATACCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005853.5-1494s21c1
Sequence:CCGGACATGGCCTTGGCAGTTATTTCTCGAGAAATAACTGCCAAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005853.5-1226s21c1
Sequence:CCGGATCCCGGCTACACGAACTATGCTCGAGCATAGTTCGTGTAGCCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005853
VALIDATED
IRX5 MISSION shRNA Lentiviral Transduction Particles
iroquois homeobox 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005853.3-1556s1c1
Sequence:CCGGCCTCCTATTCAGAAGTTTATACTCGAGTATAAACTTCTGAATAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005853.3-1428s1c1
Sequence:CCGGGAAAGGTATGTCCGACATTTACTCGAGTAAATGTCGGACATACCTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005853.3-996s1c1
Sequence:CCGGACTGTGGTCTTTGGCAGAGATCTCGAGATCTCTGCCAAAGACCACAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005853.3-1403s1c1
Sequence:CCGGGCAAAGACTCTCCCTATGAATCTCGAGATTCATAGGGAGAGTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005853.3-508s1c1
Sequence:CCGGCGCCTCAAGAAAGAGAATAAACTCGAGTTTATTCTCTTTCTTGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005853.5-65s21c1
Sequence:CCGGCGTACAGCACCAGCGTCATTTCTCGAGAAATGACGCTGGTGCTGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005853.5-1308s21c1
Sequence:CCGGGTCTCATTTCAATGGATTAAACTCGAGTTTAATCCATTGAAATGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005853.5-1430s21c1
Sequence:GTACCGGAGAAAGGTATGTCCGACATTTCTCGAGAAATGTCGGACATACCTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230624    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_005853.5-1494s21c1
Sequence:CCGGACATGGCCTTGGCAGTTATTTCTCGAGAAATAACTGCCAAGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005853.5-1226s21c1
Sequence:CCGGATCCCGGCTACACGAACTATGCTCGAGCATAGTTCGTGTAGCCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks