EMAIL THIS PAGE TO A FRIEND

ISOC1

isochorismatase domain containing 1

UniProtKB ID: Q96CN7, Q7Z770
Gene ID:
Mouse(66307) isochorismatase domain containing 1
Rat(364879) isochorismatase domain containing 1
Zebrafish(559897) isochorismatase domain containing 1
cow(540524) isochorismatase domain containing 1
domestic cat(101090835) isochorismatase domain containing 1
dog(100688371) isochorismatase domain containing 1
chicken(415601) isochorismatase domain containing 1
sheep(101102483) isochorismatase domain containing 1
domestic guinea pig(100729759) isochorismatase domain containing 1
naked mole-rat(101709879) isochorismatase domain containing 1
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016048 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016048 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016048 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016048 Rosetta Predictions human pricing
NM_001014242 Rosetta Predictions rat pricing
XM_001060492 Rosetta Predictions rat pricing
XM_344689 Rosetta Predictions rat pricing
NM_025478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219239 predicted 332
2 SASI_Hs02_00348768 predicted 540
3 SASI_Hs01_00219240 predicted 390
4 SASI_Hs01_00219241 predicted 709
5 SASI_Hs01_00219242 predicted 766
6 SASI_Hs01_00219243 predicted 369
7 SASI_Hs01_00219244 predicted 913
8 SASI_Hs01_00219245 predicted 509
9 SASI_Hs01_00219246 predicted 603
10 SASI_Hs01_00219247 predicted 778
11 SASI_Hs01_00219238 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014242 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089678 predicted 611
2 SASI_Rn02_00201804 predicted 453
3 SASI_Rn02_00201805 predicted 947
4 SASI_Rn01_00089680 predicted 968
5 SASI_Rn01_00089681 predicted 717
6 SASI_Rn01_00089683 predicted 728
7 SASI_Rn01_00089684 predicted 441
8 SASI_Rn01_00089685 predicted 432
9 SASI_Rn01_00089686 predicted 833
10 SASI_Rn01_00089687 predicted 500
11 SASI_Rn01_00089679 predicted 766
12 SASI_Rn01_00089682 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060492 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296699 predicted 540
2 SASI_Rn02_00296700 predicted 373
3 SASI_Rn02_00296701 predicted 873
4 SASI_Rn02_00296702 predicted 892
5 SASI_Rn02_00296703 predicted 644
6 SASI_Rn02_00296704 predicted 657
7 SASI_Rn02_00296705 predicted 367
8 SASI_Rn02_00296706 predicted 356
9 SASI_Rn02_00296707 predicted 759
10 SASI_Rn02_00296708 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00181633 predicted 620
2 SASI_Rn01_00181634 predicted 779
3 SASI_Rn01_00181635 predicted 978
4 SASI_Rn01_00181636 predicted 727
5 SASI_Rn01_00181637 predicted 1007
6 SASI_Rn01_00181638 predicted 748
7 SASI_Rn01_00181639 predicted 450
8 SASI_Rn01_00181640 predicted 437
9 SASI_Rn01_00181641 predicted 844
10 SASI_Rn01_00181642 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119843 predicted 620
2 SASI_Mm01_00119844 predicted 446
3 SASI_Mm01_00119846 predicted 884
4 SASI_Mm01_00119847 predicted 436
5 SASI_Mm01_00119848 predicted 613
6 SASI_Mm01_00119849 predicted 834
7 SASI_Mm01_00119850 predicted 934
8 SASI_Mm01_00119851 predicted 737
9 SASI_Mm01_00119852 predicted 974
10 SASI_Mm02_00328348 predicted 839
11 SASI_Mm01_00119845 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025478
VALIDATED
ISOC1 MISSION shRNA Bacterial Glycerol Stock
isochorismatase domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025478.3-620s21c1
Sequence:CCGGGTCGTGTTGTTTGGAGTAGAACTCGAGTTCTACTCCAAACAACACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025478.3-829s21c1
Sequence:CCGGCCACCCGAAGTTCAAGGAAATCTCGAGATTTCCTTGAACTTCGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025478.3-386s21c1
Sequence:CCGGCGTCCAGCCATCAAATACTTTCTCGAGAAAGTATTTGATGGCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025478.3-507s21c1
Sequence:CCGGCCGTTCAAGAAATCGACTTAACTCGAGTTAAGTCGATTTCTTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025478.2-829s1c1
Sequence:CCGGCCACCCGAAGTTCAAGGAAATCTCGAGATTTCCTTGAACTTCGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025478.2-2413s1c1
Sequence:CCGGGCCTAGAAGATGAGTCCAGAACTCGAGTTCTGGACTCATCTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025478.2-507s1c1
Sequence:CCGGCCGTTCAAGAAATCGACTTAACTCGAGTTAAGTCGATTTCTTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025478.2-620s1c1
Sequence:CCGGGTCGTGTTGTTTGGAGTAGAACTCGAGTTCTACTCCAAACAACACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025478.2-386s1c1
Sequence:CCGGCGTCCAGCCATCAAATACTTTCTCGAGAAAGTATTTGATGGCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025478
VALIDATED
ISOC1 MISSION shRNA shRNA Plasmid DNA
isochorismatase domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025478.3-620s21c1
Sequence:CCGGGTCGTGTTGTTTGGAGTAGAACTCGAGTTCTACTCCAAACAACACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025478.3-829s21c1
Sequence:CCGGCCACCCGAAGTTCAAGGAAATCTCGAGATTTCCTTGAACTTCGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025478.3-386s21c1
Sequence:CCGGCGTCCAGCCATCAAATACTTTCTCGAGAAAGTATTTGATGGCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025478.3-507s21c1
Sequence:CCGGCCGTTCAAGAAATCGACTTAACTCGAGTTAAGTCGATTTCTTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025478.2-829s1c1
Sequence:CCGGCCACCCGAAGTTCAAGGAAATCTCGAGATTTCCTTGAACTTCGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025478.2-2413s1c1
Sequence:CCGGGCCTAGAAGATGAGTCCAGAACTCGAGTTCTGGACTCATCTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025478.2-507s1c1
Sequence:CCGGCCGTTCAAGAAATCGACTTAACTCGAGTTAAGTCGATTTCTTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025478.2-620s1c1
Sequence:CCGGGTCGTGTTGTTTGGAGTAGAACTCGAGTTCTACTCCAAACAACACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025478.2-386s1c1
Sequence:CCGGCGTCCAGCCATCAAATACTTTCTCGAGAAAGTATTTGATGGCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025478
VALIDATED
ISOC1 MISSION shRNA Lentiviral Transduction Particles
isochorismatase domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025478.3-620s21c1
Sequence:CCGGGTCGTGTTGTTTGGAGTAGAACTCGAGTTCTACTCCAAACAACACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025478.3-829s21c1
Sequence:CCGGCCACCCGAAGTTCAAGGAAATCTCGAGATTTCCTTGAACTTCGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025478.3-386s21c1
Sequence:CCGGCGTCCAGCCATCAAATACTTTCTCGAGAAAGTATTTGATGGCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025478.3-507s21c1
Sequence:CCGGCCGTTCAAGAAATCGACTTAACTCGAGTTAAGTCGATTTCTTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025478.2-829s1c1
Sequence:CCGGCCACCCGAAGTTCAAGGAAATCTCGAGATTTCCTTGAACTTCGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025478.2-2413s1c1
Sequence:CCGGGCCTAGAAGATGAGTCCAGAACTCGAGTTCTGGACTCATCTTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025478.2-507s1c1
Sequence:CCGGCCGTTCAAGAAATCGACTTAACTCGAGTTAAGTCGATTTCTTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025478.2-620s1c1
Sequence:CCGGGTCGTGTTGTTTGGAGTAGAACTCGAGTTCTACTCCAAACAACACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025478.2-386s1c1
Sequence:CCGGCGTCCAGCCATCAAATACTTTCTCGAGAAAGTATTTGATGGCTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016048
ISOC1 MISSION shRNA Bacterial Glycerol Stock
isochorismatase domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016048.1-1075s1c1
Sequence:CCGGCCATTTGAGTACCAGCATTTACTCGAGTAAATGCTGGTACTCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016048.1-585s1c1
Sequence:CCGGCCAGAAGTAGAAGCGGCATTACTCGAGTAATGCCGCTTCTACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016048.1-334s1c1
Sequence:CCGGCCCTGGGAAATCTTACACCTTCTCGAGAAGGTGTAAGATTTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-699s1c1
Sequence:CCGGGTCGAGGTTCACATTGTTGCTCTCGAGAGCAACAATGTGAACCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-395s1c1
Sequence:CCGGCAGACCAGCCATCAAGTATTTCTCGAGAAATACTTGATGGCTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016048.1-1422s1c1
Sequence:CCGGCCTCACAATGTTGTCCACTTACTCGAGTAAGTGGACAACATTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-594s1c1
Sequence:CCGGGAAGCGGCATTAGCAGAGATTCTCGAGAATCTCTGCTAATGCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-373s1c1
Sequence:CCGGGCTGTGATATGCAGGAAAGGTCTCGAGACCTTTCCTGCATATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016048.1-702s1c1
Sequence:CCGGGAGGTTCACATTGTTGCTGATCTCGAGATCAGCAACAATGTGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-552s1c1
Sequence:CCGGGTACTTCCAAAGACCAAGTTTCTCGAGAAACTTGGTCTTTGGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016048
ISOC1 MISSION shRNA shRNA Plasmid DNA
isochorismatase domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016048.1-1075s1c1
Sequence:CCGGCCATTTGAGTACCAGCATTTACTCGAGTAAATGCTGGTACTCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016048.1-585s1c1
Sequence:CCGGCCAGAAGTAGAAGCGGCATTACTCGAGTAATGCCGCTTCTACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016048.1-334s1c1
Sequence:CCGGCCCTGGGAAATCTTACACCTTCTCGAGAAGGTGTAAGATTTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-699s1c1
Sequence:CCGGGTCGAGGTTCACATTGTTGCTCTCGAGAGCAACAATGTGAACCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-395s1c1
Sequence:CCGGCAGACCAGCCATCAAGTATTTCTCGAGAAATACTTGATGGCTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016048.1-1422s1c1
Sequence:CCGGCCTCACAATGTTGTCCACTTACTCGAGTAAGTGGACAACATTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-594s1c1
Sequence:CCGGGAAGCGGCATTAGCAGAGATTCTCGAGAATCTCTGCTAATGCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-373s1c1
Sequence:CCGGGCTGTGATATGCAGGAAAGGTCTCGAGACCTTTCCTGCATATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016048.1-702s1c1
Sequence:CCGGGAGGTTCACATTGTTGCTGATCTCGAGATCAGCAACAATGTGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-552s1c1
Sequence:CCGGGTACTTCCAAAGACCAAGTTTCTCGAGAAACTTGGTCTTTGGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016048
ISOC1 MISSION shRNA Lentiviral Transduction Particles
isochorismatase domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016048.1-1075s1c1
Sequence:CCGGCCATTTGAGTACCAGCATTTACTCGAGTAAATGCTGGTACTCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016048.1-585s1c1
Sequence:CCGGCCAGAAGTAGAAGCGGCATTACTCGAGTAATGCCGCTTCTACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016048.1-334s1c1
Sequence:CCGGCCCTGGGAAATCTTACACCTTCTCGAGAAGGTGTAAGATTTCCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140230    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-699s1c1
Sequence:CCGGGTCGAGGTTCACATTGTTGCTCTCGAGAGCAACAATGTGAACCTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-395s1c1
Sequence:CCGGCAGACCAGCCATCAAGTATTTCTCGAGAAATACTTGATGGCTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016048.1-1422s1c1
Sequence:CCGGCCTCACAATGTTGTCCACTTACTCGAGTAAGTGGACAACATTGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-594s1c1
Sequence:CCGGGAAGCGGCATTAGCAGAGATTCTCGAGAATCTCTGCTAATGCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-373s1c1
Sequence:CCGGGCTGTGATATGCAGGAAAGGTCTCGAGACCTTTCCTGCATATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016048.1-702s1c1
Sequence:CCGGGAGGTTCACATTGTTGCTGATCTCGAGATCAGCAACAATGTGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016048.1-552s1c1
Sequence:CCGGGTACTTCCAAAGACCAAGTTTCTCGAGAAACTTGGTCTTTGGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks