EMAIL THIS PAGE TO A FRIEND

ITCH

itchy E3 ubiquitin protein ligase

Synonyms: AIF4 AIP4 NAPP1 dJ468O1.1
Gene ID:
Human(83737) Summary: This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein plays a role in multiple cellular processes including erythroid and lymphoid cell differentiation and the regulation of immune responses. Mutations in this gene are a cause of syndromic multisystem autoimmune disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
Mouse(16396) itchy, E3 ubiquitin protein ligase
Rat(311567) itchy E3 ubiquitin protein ligase
Zebrafish(100331274) itchy E3 ubiquitin protein ligase homolog (mouse)
chicken(419145) itchy E3 ubiquitin protein ligase
cow(508431) itchy E3 ubiquitin protein ligase homolog (mouse)
Horse(100069340) itchy E3 ubiquitin protein ligase
domestic cat(101086133) itchy E3 ubiquitin protein ligase
dog(477199) itchy E3 ubiquitin protein ligase
sheep(101118041) itchy E3 ubiquitin protein ligase
domestic guinea pig(100724288) itchy E3 ubiquitin protein ligase
naked mole-rat(101711522) itchy E3 ubiquitin protein ligase
279 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031483 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_192925 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_192925 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_192925 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031483 Rosetta Predictions human pricing
NM_001005887 Rosetta Predictions rat pricing
NM_008395 Rosetta Predictions mouse pricing
XM_001005744 Rosetta Predictions mouse pricing
XM_192925 Rosetta Predictions mouse pricing
XM_895069 Rosetta Predictions mouse pricing
XM_902524 Rosetta Predictions mouse pricing
XM_902525 Rosetta Predictions mouse pricing
XM_902526 Rosetta Predictions mouse pricing
XM_902527 Rosetta Predictions mouse pricing
XM_902529 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114827 predicted 2861
2 SASI_Hs01_00114828 predicted 1919
3 SASI_Hs01_00114829 predicted 2873
4 SASI_Hs01_00114830 predicted 1409
5 SASI_Hs02_00358919 predicted 590
6 SASI_Hs01_00114831 predicted 581
7 SASI_Hs01_00114832 predicted 2419
8 SASI_Hs01_00114833 predicted 899
9 SASI_Hs01_00114835 predicted 1296
10 SASI_Hs02_00358920 predicted 2865
11 SASI_Hs01_00114826 predicted 2224
12 SASI_Hs01_00114834 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043367 predicted 958
2 SASI_Rn01_00043368 predicted 325
3 SASI_Rn01_00043369 predicted 1099
4 SASI_Rn01_00043370 predicted 1676
5 SASI_Rn01_00043371 predicted 292
6 SASI_Rn01_00043372 predicted 354
7 SASI_Rn01_00043373 predicted 293
8 SASI_Rn01_00043374 predicted 1383
9 SASI_Rn01_00043376 predicted 1519
10 SASI_Rn02_00198472 predicted 1790
11 SASI_Rn01_00043375 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313817 predicted 2781
2 SASI_Mm02_00313818 predicted 557
3 SASI_Mm02_00313819 predicted 1187
4 SASI_Mm02_00313820 predicted 337
5 SASI_Mm02_00313821 predicted 1370
6 SASI_Mm02_00313822 predicted 994
7 SASI_Mm02_00313823 predicted 1143
8 SASI_Mm02_00313824 predicted 642
9 SASI_Mm02_00313825 predicted 2783
10 SASI_Mm02_00313826 predicted 1745
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005744 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245370 predicted 538
2 SASI_Mm01_00245371 predicted 320
3 SASI_Mm01_00245372 predicted 566
4 SASI_Mm01_00245373 predicted 2856
5 SASI_Mm01_00245374 predicted 970
6 SASI_Mm01_00245375 predicted 1123
7 SASI_Mm01_00245376 predicted 622
8 SASI_Mm01_00245377 predicted 767
9 SASI_Mm01_00245378 predicted 469
10 SASI_Mm01_00245379 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_192925 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247793 predicted 756
2 SASI_Mm01_00247794 predicted 3069
3 SASI_Mm01_00247795 predicted 1194
4 SASI_Mm01_00247796 predicted 1352
5 SASI_Mm01_00247797 predicted 841
6 SASI_Mm01_00247798 predicted 1956
7 SASI_Mm01_00247799 predicted 1194
8 SASI_Mm01_00247800 predicted 999
9 SASI_Mm01_00247801 predicted 697
10 SASI_Mm01_00247802 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895069 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212483 predicted 486
2 SASI_Mm01_00212484 predicted 274
3 SASI_Mm01_00212485 predicted 2806
4 SASI_Mm01_00212486 predicted 924
5 SASI_Mm01_00212487 predicted 1083
6 SASI_Mm01_00212488 predicted 573
7 SASI_Mm01_00212489 predicted 1683
8 SASI_Mm01_00212490 predicted 723
9 SASI_Mm01_00212491 predicted 429
10 SASI_Mm01_00212492 predicted 465
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208576 predicted 689
2 SASI_Mm01_00208577 predicted 425
3 SASI_Mm01_00208578 predicted 539
4 SASI_Mm01_00208579 predicted 440
5 SASI_Mm01_00208580 predicted 474
6 SASI_Mm01_00208581 predicted 690
7 SASI_Mm01_00208582 predicted 521
8 SASI_Mm01_00208583 predicted 480
9 SASI_Mm01_00208584 predicted 414
10 SASI_Mm01_00208585 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254514 predicted 531
2 SASI_Mm01_00254515 predicted 321
3 SASI_Mm01_00254516 predicted 566
4 SASI_Mm01_00254517 predicted 974
5 SASI_Mm01_00254518 predicted 1129
6 SASI_Mm01_00254519 predicted 622
7 SASI_Mm01_00254520 predicted 965
8 SASI_Mm01_00254521 predicted 767
9 SASI_Mm01_00254522 predicted 475
10 SASI_Mm01_00254523 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216965 predicted 538
2 SASI_Mm01_00216966 predicted 312
3 SASI_Mm01_00216967 predicted 559
4 SASI_Mm01_00216968 predicted 968
5 SASI_Mm01_00216969 predicted 1125
6 SASI_Mm01_00216970 predicted 619
7 SASI_Mm01_00216971 predicted 974
8 SASI_Mm01_00216972 predicted 767
9 SASI_Mm01_00216973 predicted 476
10 SASI_Mm01_00216974 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262681 predicted 531
2 SASI_Mm01_00262682 predicted 321
3 SASI_Mm01_00262683 predicted 2850
4 SASI_Mm01_00262684 predicted 973
5 SASI_Mm01_00262685 predicted 1125
6 SASI_Mm01_00262686 predicted 615
7 SASI_Mm01_00262687 predicted 1726
8 SASI_Mm01_00262688 predicted 768
9 SASI_Mm01_00262689 predicted 475
10 SASI_Mm01_00262690 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902529 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283114 predicted 539
2 SASI_Mm01_00283115 predicted 314
3 SASI_Mm01_00283116 predicted 558
4 SASI_Mm01_00283117 predicted 2840
5 SASI_Mm01_00283118 predicted 967
6 SASI_Mm01_00283119 predicted 615
7 SASI_Mm01_00283120 predicted 971
8 SASI_Mm01_00283121 predicted 765
9 SASI_Mm01_00283122 predicted 474
10 SASI_Mm01_00283123 predicted 515
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008395
ITCH MISSION shRNA Bacterial Glycerol Stock
itchy E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000431248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008395.2-2863s21c1
Sequence:CCGGTGCCTGTTGCACATCTTATTGCTCGAGCAATAAGATGTGCAACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008395.2-1189s21c1
Sequence:CCGGTGGACAATATGGGACGTATTTCTCGAGAAATACGTCCCATATTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008395.2-3152s21c1
Sequence:CCGGGACATCTCGGAAACGCAATACCTCGAGGTATTGCGTTTCCGAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008395.2-2906s21c1
Sequence:CCGGAGTTACCTGAGAGTAAGTAAACTCGAGTTTACTTACTCTCAGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008395
ITCH MISSION shRNA shRNA Plasmid DNA
itchy E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000431248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008395.2-2863s21c1
Sequence:CCGGTGCCTGTTGCACATCTTATTGCTCGAGCAATAAGATGTGCAACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008395.2-1189s21c1
Sequence:CCGGTGGACAATATGGGACGTATTTCTCGAGAAATACGTCCCATATTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008395.2-3152s21c1
Sequence:CCGGGACATCTCGGAAACGCAATACCTCGAGGTATTGCGTTTCCGAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008395.2-2906s21c1
Sequence:CCGGAGTTACCTGAGAGTAAGTAAACTCGAGTTTACTTACTCTCAGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008395
ITCH MISSION shRNA Lentiviral Transduction Particles
itchy E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000431248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008395.2-2863s21c1
Sequence:CCGGTGCCTGTTGCACATCTTATTGCTCGAGCAATAAGATGTGCAACAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008395.2-1189s21c1
Sequence:CCGGTGGACAATATGGGACGTATTTCTCGAGAAATACGTCCCATATTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008395.2-3152s21c1
Sequence:CCGGGACATCTCGGAAACGCAATACCTCGAGGTATTGCGTTTCCGAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008395.2-2906s21c1
Sequence:CCGGAGTTACCTGAGAGTAAGTAAACTCGAGTTTACTTACTCTCAGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031483
VALIDATED
ITCH MISSION shRNA Bacterial Glycerol Stock
itchy E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031483.4-1439s21c1
Sequence:CCGGTCAACCACAACACACGAATTACTCGAGTAATTCGTGTGTTGTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031483.4-2454s21c1
Sequence:CCGGACATGCCATCTACCGTCATTACTCGAGTAATGACGGTAGATGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031483.4-1174s21c1
Sequence:CCGGGACAACATGGGACGTATTTATCTCGAGATAAATACGTCCCATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031483.x-1767s1c1
Sequence:CCGGCGAAGACGTTTGTGGGTGATTCTCGAGAATCACCCACAAACGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031483.x-5199s1c1
Sequence:CCGGCCCAAGAATCAGAGGTTATATCTCGAGATATAACCTCTGATTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031483.x-1453s1c1
Sequence:CCGGCCAGAAGTCAAGGTCAATTAACTCGAGTTAATTGACCTTGACTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031483.x-914s1c1
Sequence:CCGGGCCGACAAATACAAATACAAACTCGAGTTTGTATTTGTATTTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031483.x-1614s1c1
Sequence:CCGGGCCTATGTTCGGGACTTCAAACTCGAGTTTGAAGTCCCGAACATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031483
VALIDATED
ITCH MISSION shRNA shRNA Plasmid DNA
itchy E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031483.4-1439s21c1
Sequence:CCGGTCAACCACAACACACGAATTACTCGAGTAATTCGTGTGTTGTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031483.4-2454s21c1
Sequence:CCGGACATGCCATCTACCGTCATTACTCGAGTAATGACGGTAGATGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031483.4-1174s21c1
Sequence:CCGGGACAACATGGGACGTATTTATCTCGAGATAAATACGTCCCATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031483.x-1767s1c1
Sequence:CCGGCGAAGACGTTTGTGGGTGATTCTCGAGAATCACCCACAAACGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031483.x-5199s1c1
Sequence:CCGGCCCAAGAATCAGAGGTTATATCTCGAGATATAACCTCTGATTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031483.x-1453s1c1
Sequence:CCGGCCAGAAGTCAAGGTCAATTAACTCGAGTTAATTGACCTTGACTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031483.x-914s1c1
Sequence:CCGGGCCGACAAATACAAATACAAACTCGAGTTTGTATTTGTATTTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031483.x-1614s1c1
Sequence:CCGGGCCTATGTTCGGGACTTCAAACTCGAGTTTGAAGTCCCGAACATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031483
VALIDATED
ITCH MISSION shRNA Lentiviral Transduction Particles
itchy E3 ubiquitin protein ligase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031483.4-1439s21c1
Sequence:CCGGTCAACCACAACACACGAATTACTCGAGTAATTCGTGTGTTGTGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031483.4-2454s21c1
Sequence:CCGGACATGCCATCTACCGTCATTACTCGAGTAATGACGGTAGATGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_031483.4-1174s21c1
Sequence:CCGGGACAACATGGGACGTATTTATCTCGAGATAAATACGTCCCATGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031483.x-1767s1c1
Sequence:CCGGCGAAGACGTTTGTGGGTGATTCTCGAGAATCACCCACAAACGTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031483.x-5199s1c1
Sequence:CCGGCCCAAGAATCAGAGGTTATATCTCGAGATATAACCTCTGATTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031483.x-1453s1c1
Sequence:CCGGCCAGAAGTCAAGGTCAATTAACTCGAGTTAATTGACCTTGACTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031483.x-914s1c1
Sequence:CCGGGCCGACAAATACAAATACAAACTCGAGTTTGTATTTGTATTTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031483.x-1614s1c1
Sequence:CCGGGCCTATGTTCGGGACTTCAAACTCGAGTTTGAAGTCCCGAACATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_192925
ITCH MISSION shRNA Bacterial Glycerol Stock
itchy E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000026914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192925.3-2380s1c1
Sequence:CCGGGCGAAGGAATTAGAGGTTCTTCTCGAGAAGAACCTCTAATTCCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192925.3-396s1c1
Sequence:CCGGCCCTACGAGTAAATTATGTTTCTCGAGAAACATAATTTACTCGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192925.3-1290s1c1
Sequence:CCGGGCAGCAGTTTAACCAGAGATTCTCGAGAATCTCTGGTTAAACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192925.3-1956s1c1
Sequence:CCGGCCACCTGAAATACTTTCGTTTCTCGAGAAACGAAAGTATTTCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_192925
ITCH MISSION shRNA shRNA Plasmid DNA
itchy E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000026914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192925.3-2380s1c1
Sequence:CCGGGCGAAGGAATTAGAGGTTCTTCTCGAGAAGAACCTCTAATTCCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192925.3-396s1c1
Sequence:CCGGCCCTACGAGTAAATTATGTTTCTCGAGAAACATAATTTACTCGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192925.3-1290s1c1
Sequence:CCGGGCAGCAGTTTAACCAGAGATTCTCGAGAATCTCTGGTTAAACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192925.3-1956s1c1
Sequence:CCGGCCACCTGAAATACTTTCGTTTCTCGAGAAACGAAAGTATTTCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_192925
ITCH MISSION shRNA Lentiviral Transduction Particles
itchy E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000026914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192925.3-2380s1c1
Sequence:CCGGGCGAAGGAATTAGAGGTTCTTCTCGAGAAGAACCTCTAATTCCTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192925.3-396s1c1
Sequence:CCGGCCCTACGAGTAAATTATGTTTCTCGAGAAACATAATTTACTCGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192925.3-1290s1c1
Sequence:CCGGGCAGCAGTTTAACCAGAGATTCTCGAGAATCTCTGGTTAAACTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_192925.3-1956s1c1
Sequence:CCGGCCACCTGAAATACTTTCGTTTCTCGAGAAACGAAAGTATTTCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks