EMAIL THIS PAGE TO A FRIEND

ITGA11

integrin, alpha 11

Synonyms: HsT18964
UniProtKB ID: Q9UKX5, Q8WYI8, Q9UKQ1
Gene ID:
Human(22801) Summary: This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
Mouse(319480) integrin alpha 11
Rat(315744) integrin, alpha 11
sheep(101105162) integrin, alpha 11
Domestic Rabbit(100344251) integrin, alpha 11
domestic guinea pig(100730700) integrin, alpha 11
naked mole-rat(101710116) integrin, alpha 11
chicken(415560) integrin, alpha 11
dog(478353) integrin, alpha 11
Horse(100065211) integrin, alpha 11
cow(523755) integrin, alpha 11
domestic cat(101093524) integrin, alpha 11
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004439 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004439 Rosetta Predictions human pricing
NM_012211 Rosetta Predictions human pricing
NM_001108156 Rosetta Predictions rat pricing
NM_176922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137561 predicted 819
2 SASI_Hs01_00137562 predicted 230
3 SASI_Hs01_00137566 predicted 1688
4 SASI_Hs01_00137567 predicted 946
5 SASI_Hs01_00137568 predicted 1449
6 SASI_Hs01_00137569 predicted 2270
7 SASI_Hs01_00137570 predicted 1628
8 SASI_Hs02_00304588 predicted 1419
9 SASI_Hs02_00304589 predicted 1244
10 SASI_Hs02_00304590 predicted 2305
11 SASI_Hs01_00137563 predicted 2019
12 SASI_Hs01_00137564 predicted 3326
13 SASI_Hs01_00137565 predicted 1681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012211 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191804 predicted 825
2 SASI_Hs01_00191805 predicted 235
3 SASI_Hs01_00191806 predicted 2026
4 SASI_Hs01_00191807 predicted 3323
5 SASI_Hs01_00191808 predicted 1676
6 SASI_Hs01_00191809 predicted 1693
7 SASI_Hs01_00191810 predicted 945
8 SASI_Hs01_00191811 predicted 1457
9 SASI_Hs01_00191812 predicted 2282
10 SASI_Hs01_00191813 predicted 1639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235904 predicted 786
2 SASI_Rn02_00235905 predicted 2615
3 SASI_Rn02_00235906 predicted 1060
4 SASI_Rn02_00235907 predicted 1402
5 SASI_Rn02_00235908 predicted 669
6 SASI_Rn02_00235909 predicted 3359
7 SASI_Rn02_00235910 predicted 2441
8 SASI_Rn02_00235911 predicted 1109
9 SASI_Rn02_00235912 predicted 3352
10 SASI_Rn02_00235913 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171659 predicted 2632
2 SASI_Mm02_00346810 predicted 1623
3 SASI_Mm01_00171660 predicted 698
4 SASI_Mm01_00171662 predicted 2991
5 SASI_Mm01_00171663 predicted 1742
6 SASI_Mm01_00171664 predicted 1507
7 SASI_Mm01_00171665 predicted 680
8 SASI_Mm01_00171666 predicted 511
9 SASI_Mm01_00171667 predicted 298
10 SASI_Mm01_00171668 predicted 472
11 SASI_Mm01_00171661 predicted 3756
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004439
VALIDATED
ITGA11 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 11
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004439.1-3851s21c1
Sequence:CCGGGGAGACTGGGACACCTTTAACCTCGAGGTTAAAGGTGTCCCAGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004439.1-2925s21c1
Sequence:CCGGCTTACGCTTCCACCTCAAATACTCGAGTATTTGAGGTGGAAGCGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004439.1-811s21c1
Sequence:CCGGACGGCATTTGGCATTGAATTTCTCGAGAAATTCAATGCCAAATGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004439.1-1693s21c1
Sequence:CCGGAGTTACCAGAATGCCCGATTTCTCGAGAAATCGGGCATTCTGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004439.1-4726s1c1
Sequence:CCGGCCCTCTGGAATGCACTGAATACTCGAGTATTCAGTGCATTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004439.1-2031s1c1
Sequence:CCGGGCCATCCAAGATCAACATCTTCTCGAGAAGATGTTGATCTTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004439.1-1517s1c1
Sequence:CCGGGCTCTTACTTTGGGAGTGAAACTCGAGTTTCACTCCCAAAGTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004439.1-3012s1c1
Sequence:CCGGGCTGGAGAGATACGATGGTATCTCGAGATACCATCGTATCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004439.1-228s1c1
Sequence:CCGGGCACGACATCAGTGGCAATAACTCGAGTTATTGCCACTGATGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004439
VALIDATED
ITGA11 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 11
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004439.1-3851s21c1
Sequence:CCGGGGAGACTGGGACACCTTTAACCTCGAGGTTAAAGGTGTCCCAGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004439.1-2925s21c1
Sequence:CCGGCTTACGCTTCCACCTCAAATACTCGAGTATTTGAGGTGGAAGCGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004439.1-811s21c1
Sequence:CCGGACGGCATTTGGCATTGAATTTCTCGAGAAATTCAATGCCAAATGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004439.1-1693s21c1
Sequence:CCGGAGTTACCAGAATGCCCGATTTCTCGAGAAATCGGGCATTCTGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004439.1-4726s1c1
Sequence:CCGGCCCTCTGGAATGCACTGAATACTCGAGTATTCAGTGCATTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004439.1-2031s1c1
Sequence:CCGGGCCATCCAAGATCAACATCTTCTCGAGAAGATGTTGATCTTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004439.1-1517s1c1
Sequence:CCGGGCTCTTACTTTGGGAGTGAAACTCGAGTTTCACTCCCAAAGTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004439.1-3012s1c1
Sequence:CCGGGCTGGAGAGATACGATGGTATCTCGAGATACCATCGTATCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004439.1-228s1c1
Sequence:CCGGGCACGACATCAGTGGCAATAACTCGAGTTATTGCCACTGATGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004439
VALIDATED
ITGA11 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 11
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004439.1-3851s21c1
Sequence:CCGGGGAGACTGGGACACCTTTAACCTCGAGGTTAAAGGTGTCCCAGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004439.1-2925s21c1
Sequence:CCGGCTTACGCTTCCACCTCAAATACTCGAGTATTTGAGGTGGAAGCGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004439.1-811s21c1
Sequence:CCGGACGGCATTTGGCATTGAATTTCTCGAGAAATTCAATGCCAAATGCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004439.1-1693s21c1
Sequence:CCGGAGTTACCAGAATGCCCGATTTCTCGAGAAATCGGGCATTCTGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057753    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004439.1-4726s1c1
Sequence:CCGGCCCTCTGGAATGCACTGAATACTCGAGTATTCAGTGCATTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004439.1-2031s1c1
Sequence:CCGGGCCATCCAAGATCAACATCTTCTCGAGAAGATGTTGATCTTGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004439.1-1517s1c1
Sequence:CCGGGCTCTTACTTTGGGAGTGAAACTCGAGTTTCACTCCCAAAGTAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004439.1-3012s1c1
Sequence:CCGGGCTGGAGAGATACGATGGTATCTCGAGATACCATCGTATCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001004439.1-228s1c1
Sequence:CCGGGCACGACATCAGTGGCAATAACTCGAGTTATTGCCACTGATGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176922
ITGA11 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-806s1c1
Sequence:CCGGGCACGGCATTTGGCATTGAATCTCGAGATTCAATGCCAAATGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-1148s1c1
Sequence:CCGGCCAACAAGAATGAGACCTCTTCTCGAGAAGAGGTCTCATTCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-149s1c1
Sequence:CCGGCCTTCAATATGGATACCAGAACTCGAGTTCTGGTATCCATATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-1989s1c1
Sequence:CCGGCCGCCCTGTAGTTCAAATCAACTCGAGTTGATTTGAACTACAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-3141s1c1
Sequence:CCGGGCTGATGTTGAGGGACTTCTTCTCGAGAAGAAGTCCCTCAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176922
ITGA11 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-806s1c1
Sequence:CCGGGCACGGCATTTGGCATTGAATCTCGAGATTCAATGCCAAATGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-1148s1c1
Sequence:CCGGCCAACAAGAATGAGACCTCTTCTCGAGAAGAGGTCTCATTCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-149s1c1
Sequence:CCGGCCTTCAATATGGATACCAGAACTCGAGTTCTGGTATCCATATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-1989s1c1
Sequence:CCGGCCGCCCTGTAGTTCAAATCAACTCGAGTTGATTTGAACTACAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-3141s1c1
Sequence:CCGGGCTGATGTTGAGGGACTTCTTCTCGAGAAGAAGTCCCTCAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176922
ITGA11 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-806s1c1
Sequence:CCGGGCACGGCATTTGGCATTGAATCTCGAGATTCAATGCCAAATGCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-1148s1c1
Sequence:CCGGCCAACAAGAATGAGACCTCTTCTCGAGAAGAGGTCTCATTCTTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-149s1c1
Sequence:CCGGCCTTCAATATGGATACCAGAACTCGAGTTCTGGTATCCATATTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-1989s1c1
Sequence:CCGGCCGCCCTGTAGTTCAAATCAACTCGAGTTGATTTGAACTACAGGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176922.4-3141s1c1
Sequence:CCGGGCTGATGTTGAGGGACTTCTTCTCGAGAAGAAGTCCCTCAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks