EMAIL THIS PAGE TO A FRIEND

ITGA1

integrin, alpha 1

Synonyms: CD49a VLA1
UniProtKB ID: P56199, B2RNU0
Gene ID:
Human(3672) Summary: This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
Mouse(109700) integrin alpha 1
Rat(25118) integrin, alpha 1
sheep(101114307) integrin, alpha 1
Domestic Rabbit(100342711) integrin, alpha 1
domestic guinea pig(100729544) integrin, alpha 1
naked mole-rat(101703242) integrin, alpha 1
Zebrafish(570868) integrin, alpha 1
chicken(395951) integrin, alpha 1
cow(535951) integrin, alpha 1
Horse(100063434) integrin, alpha 1
domestic cat(101089743) integrin, alpha 1
dog(489210) integrin, alpha 1
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181501 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181501 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181501 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033228 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033228 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033228 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181501 Rosetta Predictions human pricing
NM_030994 Rosetta Predictions rat pricing
NM_001033228 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067020 predicted 2287
2 SASI_Hs01_00067021 predicted 1817
3 SASI_Hs01_00067022 predicted 2380
4 SASI_Hs01_00067023 predicted 1503
5 SASI_Hs01_00067025 predicted 3689
6 SASI_Hs01_00067026 predicted 703
7 SASI_Hs02_00370115 predicted 230
8 SASI_Hs02_00370116 predicted 271
9 SASI_Hs02_00370117 predicted 548
10 SASI_Hs02_00370118 predicted 1666
11 SASI_Hs01_00067018 predicted 3049
12 SASI_Hs01_00067019 predicted 1549
13 SASI_Hs01_00067024 predicted 795
14 SASI_Hs01_00067027 predicted 3294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030994 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102479 predicted 2383
2 SASI_Rn01_00102480 predicted 2626
3 SASI_Rn01_00102481 predicted 2889
4 SASI_Rn01_00102482 predicted 3706
5 SASI_Rn01_00102483 predicted 614
6 SASI_Rn02_00264163 predicted 1046
7 SASI_Rn01_00102484 predicted 2771
8 SASI_Rn01_00102485 predicted 2313
9 SASI_Rn02_00264164 predicted 2500
10 SASI_Rn01_00102488 predicted 2046
11 SASI_Rn01_00102486 predicted 3368
12 SASI_Rn01_00102487 predicted 2610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00102775 predicted 2412
2 SASI_Mm02_00288356 predicted 3918
3 SASI_Mm01_00102777 predicted 1885
4 SASI_Mm01_00102778 predicted 2725
5 SASI_Mm01_00102779 predicted 2564
6 SASI_Mm01_00102780 predicted 1037
7 SASI_Mm01_00102781 predicted 884
8 SASI_Mm01_00102782 predicted 1066
9 SASI_Mm01_00102783 predicted 2547
10 SASI_Mm01_00102784 predicted 2661
11 SASI_Mm01_00102776 predicted 3683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181501
ITGA1 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181501.1-1391s21c1
Sequence:CCCGTCTGGAGATGTGCTCTATATTCTCGAGAATATAGAGCACATCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181501.1-4005s21c1
Sequence:CCGGGACAGTCAGCACTCGTAAATGCTCGAGCATTTACGAGTGCTGACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181501.1-2226s1c1
Sequence:CCGGCCCTAGATTCACTAAGACAAACTCGAGTTTGTCTTAGTGAATCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181501.1-637s1c1
Sequence:CCGGCCTTCTTGAAAGAATGGATATCTCGAGATATCCATTCTTTCAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181501.1-1640s1c1
Sequence:CCGGGCTCTCAATCAGACAAGGTTTCTCGAGAAACCTTGTCTGATTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181501.1-509s1c1
Sequence:CCGGCCCACATTTCAAGTCGTGAATCTCGAGATTCACGACTTGAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181501
ITGA1 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181501.1-1391s21c1
Sequence:CCCGTCTGGAGATGTGCTCTATATTCTCGAGAATATAGAGCACATCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181501.1-4005s21c1
Sequence:CCGGGACAGTCAGCACTCGTAAATGCTCGAGCATTTACGAGTGCTGACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181501.1-2226s1c1
Sequence:CCGGCCCTAGATTCACTAAGACAAACTCGAGTTTGTCTTAGTGAATCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181501.1-637s1c1
Sequence:CCGGCCTTCTTGAAAGAATGGATATCTCGAGATATCCATTCTTTCAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181501.1-1640s1c1
Sequence:CCGGGCTCTCAATCAGACAAGGTTTCTCGAGAAACCTTGTCTGATTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181501.1-509s1c1
Sequence:CCGGCCCACATTTCAAGTCGTGAATCTCGAGATTCACGACTTGAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181501
ITGA1 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181501.1-1391s21c1
Sequence:CCCGTCTGGAGATGTGCTCTATATTCTCGAGAATATAGAGCACATCTCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181501.1-4005s21c1
Sequence:CCGGGACAGTCAGCACTCGTAAATGCTCGAGCATTTACGAGTGCTGACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181501.1-2226s1c1
Sequence:CCGGCCCTAGATTCACTAAGACAAACTCGAGTTTGTCTTAGTGAATCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181501.1-637s1c1
Sequence:CCGGCCTTCTTGAAAGAATGGATATCTCGAGATATCCATTCTTTCAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181501.1-1640s1c1
Sequence:CCGGGCTCTCAATCAGACAAGGTTTCTCGAGAAACCTTGTCTGATTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181501.1-509s1c1
Sequence:CCGGCCCACATTTCAAGTCGTGAATCTCGAGATTCACGACTTGAAATGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033228
ITGA1 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033228.3-1769s21c1
Sequence:CCGGCCGGGAGATGTGCTCTATATCCTCGAGGATATAGAGCACATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033228.3-3332s21c1
Sequence:CCGGACTGTTCCTGAGCTGATTAATCTCGAGATTAATCAGCTCAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033228.3-4646s21c1
Sequence:CCGGGAGCGCACTGAATCTATTAATCTCGAGATTAATAGATTCAGTGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033228.3-2048s21c1
Sequence:CCGGATGAGCCTGGAACCAATTAAGCTCGAGCTTAATTGGTTCCAGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033228.3-1571s21c1
Sequence:CCGGACCGGCTTCAGTGCTCATTATCTCGAGATAATGAGCACTGAAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033228
ITGA1 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033228.3-1769s21c1
Sequence:CCGGCCGGGAGATGTGCTCTATATCCTCGAGGATATAGAGCACATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033228.3-3332s21c1
Sequence:CCGGACTGTTCCTGAGCTGATTAATCTCGAGATTAATCAGCTCAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033228.3-4646s21c1
Sequence:CCGGGAGCGCACTGAATCTATTAATCTCGAGATTAATAGATTCAGTGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033228.3-2048s21c1
Sequence:CCGGATGAGCCTGGAACCAATTAAGCTCGAGCTTAATTGGTTCCAGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033228.3-1571s21c1
Sequence:CCGGACCGGCTTCAGTGCTCATTATCTCGAGATAATGAGCACTGAAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033228
ITGA1 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033228.3-1769s21c1
Sequence:CCGGCCGGGAGATGTGCTCTATATCCTCGAGGATATAGAGCACATCTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033228.3-3332s21c1
Sequence:CCGGACTGTTCCTGAGCTGATTAATCTCGAGATTAATCAGCTCAGGAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254180    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033228.3-4646s21c1
Sequence:CCGGGAGCGCACTGAATCTATTAATCTCGAGATTAATAGATTCAGTGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033228.3-2048s21c1
Sequence:CCGGATGAGCCTGGAACCAATTAAGCTCGAGCTTAATTGGTTCCAGGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033228.3-1571s21c1
Sequence:CCGGACCGGCTTCAGTGCTCATTATCTCGAGATAATGAGCACTGAAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks