EMAIL THIS PAGE TO A FRIEND

ITGA3

integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)

Synonyms: CD49C GAP-B3 GAPB3 ILNEB MSK18 VCA-2 VL3A VLA3a
UniProtKB ID: P26006, A7E246, B7ZM80, B9EGQ1, D3DTX4, D3DTX5
Gene ID:
Human(3675) Summary: The protein encoded by this gene belongs to the family of integrins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain, and function as cell surface adhesion molecules. This gene encodes alpha 3 subunit, which undergoes post-translational cleavage in the extracellular domain to yield disulfide-linked light and heavy chains that join with beta 1 subunit to form an integrin that interacts with many extracellular-matrix proteins. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008]
Mouse(16400) integrin alpha 3
Rat(360606) integrin, alpha 3
domestic guinea pig(100734983) integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
naked mole-rat(101699399) integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
sheep(101118038) integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
chicken(373946) integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
dog(491074) integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
domestic cat(101093156) integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
cow(508490) integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
Horse(100056202) integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
152 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002204 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
MAB1992 Anti-Integrin α3β1 Antibody, clone M-KID2 100 µg, Anti-Integrin α3β1 Antibody, clone M-KID2 detects level of Integrin α3β1 & has been published & validated for use in ELISA, IP, RIA, IC, IH(P). pricing
AB1920 Anti-Integrin α3 Antibody 100 µL, Detect Integrin α3 using this Anti-Integrin α3 Antibody validated for use in ELISA, IF, IH, IP, RIA & WB. pricing
MAB2056 Anti-Integrin α3 Antibody, clone ASC-1 100 µg, Anti-Integrin α3 Antibody, clone ASC-1 detects level of Integrin α3 & has been published & validated for use in FC, IP, IH. pricing
MAB2056Z Anti-Integrin α3 Antibody, clone ASC-1 (Azide Free) 100 µg, Anti-Integrin α3 Antibody, clone ASC-1 (Azide Free) inhibits cell attachment & detects level of Integrin α3 & has been published & validated for use in FC, IP, IH, Inhibition Assays. pricing
MAB2057 Anti-Integrin α3 Antibody, clone ASC-6 100 µg, Anti-Integrin α3 Antibody, clone ASC-6 is an antibody against Integrin α3 for use in FC, IP, IH. pricing
MAB1952 Anti-Integrin α3 Antibody, clone P1B5 100 µL, This Anti-Integrin α3 Antibody, clone P1B5 is validated for use in IC, IH(P), FUNC for the detection of Integrin α3. pricing
MAB1952P Anti-Integrin α3 Antibody, clone P1B5 100 µg, Detect Integrin α3 using this Anti-Integrin α3 Antibody, clone P1B5 validated for use in IC, IH(P). pricing
MAB1952Z Anti-Integrin α3 Antibody, clone P1B5, azide free 100 µg, Anti-Integrin α3 Antibody, clone P1B5, azide free detects level of Integrin α3 & has been published & validated for use in IC, IH(P). pricing
MAB2290 Anti-Integrin α3 Antibody, cytoplasmic domain, clone 29A3 100 µg, Anti-Integrin α3 Antibody, cytoplasmic domain, clone 29A3 is an antibody against Integrin α3 for use in WB, IC, IH. pricing
MAB2291 Anti-Integrin α3 Antibody, cytoplasmic domain, clone 54B3 100 µg, This Anti-Integrin α3 Antibody, cytoplasmic domain, clone 54B3 is validated for use in WB, IC, IH for the detection of Integrin α3. pricing
FCMAB387APC Milli-Mark® Anti-Integrin α3-APC Antibody, clone P1B5 100 tests, This Milli-Mark Anti-Integrin α3-APC Antibody, clone P1B5 is validated for use in Flow Cytometry for the detection of Milli-Mark Integrin α3-APC. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002204 Rosetta Predictions human pricing
NM_005501 Rosetta Predictions human pricing
NM_001108292 Rosetta Predictions rat pricing
NM_013565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196571 predicted 1633
2 SASI_Hs01_00196572 predicted 1202
3 SASI_Hs01_00196573 predicted 2754
4 SASI_Hs01_00196574 predicted 1751
5 SASI_Hs01_00196575 predicted 1638
6 SASI_Hs01_00196576 predicted 1805
7 SASI_Hs01_00196577 predicted 2962
8 SASI_Hs01_00196578 predicted 1008
9 SASI_Hs01_00196579 predicted 1654
10 SASI_Hs01_00196580 predicted 1132
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126334 predicted 1631
2 SASI_Hs01_00126335 predicted 1197
3 SASI_Hs01_00126336 predicted 2752
4 SASI_Hs01_00126337 predicted 1748
5 SASI_Hs01_00126338 predicted 1634
6 SASI_Hs01_00126339 predicted 1805
7 SASI_Hs01_00126340 predicted 2965
8 SASI_Hs01_00126341 predicted 1009
9 SASI_Hs01_00126342 predicted 1655
10 SASI_Hs01_00126343 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108292 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237219 predicted 1732
2 SASI_Rn02_00237220 predicted 2599
3 SASI_Rn02_00237221 predicted 3128
4 SASI_Rn02_00237222 predicted 1964
5 SASI_Rn02_00237223 predicted 1583
6 SASI_Rn02_00237224 predicted 1692
7 SASI_Rn02_00237225 predicted 2929
8 SASI_Rn02_00237226 predicted 2936
9 SASI_Rn02_00237227 predicted 3283
10 SASI_Rn02_00237228 predicted 2349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131124 predicted 2879
2 SASI_Mm01_00131125 predicted 3511
3 SASI_Mm01_00131126 predicted 2932
4 SASI_Mm01_00131127 predicted 1044
5 SASI_Mm01_00131128 predicted 860
6 SASI_Mm01_00131129 predicted 2291
7 SASI_Mm01_00131130 predicted 1366
8 SASI_Mm01_00131131 predicted 2022
9 SASI_Mm01_00131132 predicted 3213
10 SASI_Mm02_00322305 predicted 3600
11 SASI_Mm01_00131123 predicted 3617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002204
ITGA3 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-386s1c1
Sequence:CCGGCGGATGAACATCACAGTGAAACTCGAGTTTCACTGTGATGTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-2356s1c1
Sequence:CCGGGACCTCGCTTAGCATGGTAAACTCGAGTTTACCATGCTAAGCGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-814s1c1
Sequence:CCGGCCTCTATATTGGGTACACGATCTCGAGATCGTGTACCCAATATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-1213s1c1
Sequence:CCGGCCAGGATGGATTTCAGGATATCTCGAGATATCCTGAAATCCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-2887s1c1
Sequence:CCGGCATCGAGGATTACAGAGACTTCTCGAGAAGTCTCTGTAATCCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002204.2-2395s21c1
Sequence:CCGGACAGCAGAGACGTCCGGAAATCTCGAGATTTCCGGACGTCTCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002204.2-1161s21c1
Sequence:CCGGGACTTATCTGAGTATAGTTACCTCGAGGTAACTATACTCAGATAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002204
ITGA3 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-386s1c1
Sequence:CCGGCGGATGAACATCACAGTGAAACTCGAGTTTCACTGTGATGTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-2356s1c1
Sequence:CCGGGACCTCGCTTAGCATGGTAAACTCGAGTTTACCATGCTAAGCGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-814s1c1
Sequence:CCGGCCTCTATATTGGGTACACGATCTCGAGATCGTGTACCCAATATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-1213s1c1
Sequence:CCGGCCAGGATGGATTTCAGGATATCTCGAGATATCCTGAAATCCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-2887s1c1
Sequence:CCGGCATCGAGGATTACAGAGACTTCTCGAGAAGTCTCTGTAATCCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002204.2-2395s21c1
Sequence:CCGGACAGCAGAGACGTCCGGAAATCTCGAGATTTCCGGACGTCTCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002204.2-1161s21c1
Sequence:CCGGGACTTATCTGAGTATAGTTACCTCGAGGTAACTATACTCAGATAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002204
ITGA3 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-386s1c1
Sequence:CCGGCGGATGAACATCACAGTGAAACTCGAGTTTCACTGTGATGTTCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-2356s1c1
Sequence:CCGGGACCTCGCTTAGCATGGTAAACTCGAGTTTACCATGCTAAGCGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-814s1c1
Sequence:CCGGCCTCTATATTGGGTACACGATCTCGAGATCGTGTACCCAATATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-1213s1c1
Sequence:CCGGCCAGGATGGATTTCAGGATATCTCGAGATATCCTGAAATCCATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002204.1-2887s1c1
Sequence:CCGGCATCGAGGATTACAGAGACTTCTCGAGAAGTCTCTGTAATCCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002204.2-2395s21c1
Sequence:CCGGACAGCAGAGACGTCCGGAAATCTCGAGATTTCCGGACGTCTCTGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002204.2-1161s21c1
Sequence:CCGGGACTTATCTGAGTATAGTTACCTCGAGGTAACTATACTCAGATAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013565
ITGA3 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-691s1c1
Sequence:CCGGCGGATGGACATTTCAGAGAAACTCGAGTTTCTCTGAAATGTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-2463s1c1
Sequence:CCGGCCAAGCTAATAACGAGACCATCTCGAGATGGTCTCGTTATTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-3270s1c1
Sequence:CCGGCCCTACCATCAACATGGAGAACTCGAGTTCTCCATGTTGATGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-2668s1c1
Sequence:CCGGGCCTCGCTCAGCTTAATGAATCTCGAGATTCATTAAGCTGAGCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-1366s1c1
Sequence:CCGGCCCTACTACTTCGAACGGAAACTCGAGTTTCCGTTCGAAGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013565
ITGA3 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-691s1c1
Sequence:CCGGCGGATGGACATTTCAGAGAAACTCGAGTTTCTCTGAAATGTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-2463s1c1
Sequence:CCGGCCAAGCTAATAACGAGACCATCTCGAGATGGTCTCGTTATTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-3270s1c1
Sequence:CCGGCCCTACCATCAACATGGAGAACTCGAGTTCTCCATGTTGATGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-2668s1c1
Sequence:CCGGGCCTCGCTCAGCTTAATGAATCTCGAGATTCATTAAGCTGAGCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-1366s1c1
Sequence:CCGGCCCTACTACTTCGAACGGAAACTCGAGTTTCCGTTCGAAGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013565
ITGA3 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-691s1c1
Sequence:CCGGCGGATGGACATTTCAGAGAAACTCGAGTTTCTCTGAAATGTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-2463s1c1
Sequence:CCGGCCAAGCTAATAACGAGACCATCTCGAGATGGTCTCGTTATTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-3270s1c1
Sequence:CCGGCCCTACCATCAACATGGAGAACTCGAGTTCTCCATGTTGATGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-2668s1c1
Sequence:CCGGGCCTCGCTCAGCTTAATGAATCTCGAGATTCATTAAGCTGAGCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013565.2-1366s1c1
Sequence:CCGGCCCTACTACTTCGAACGGAAACTCGAGTTTCCGTTCGAAGTAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks