EMAIL THIS PAGE TO A FRIEND

ITGA9

integrin, alpha 9

Synonyms: ALPHA-RLC ITGA4L RLC
UniProtKB ID: Q13797, Q14638
Gene ID:
Human(3680) Summary: This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane glycoproteins composed of an alpha chain and a beta chain that mediate cell-cell and cell-matrix adhesion. The protein encoded by this gene, when bound to the beta 1 chain, forms an integrin that is a receptor for VCAM1, cytotactin and osteopontin. Expression of this gene has been found to be upregulated in small cell lung cancers. [provided by RefSeq, Jul 2008]
Mouse(104099) integrin alpha 9
Rat(685004) integrin, alpha 9
Zebrafish(394012) integrin, alpha 9
Zebrafish(100536760) integrin, alpha 9
cow(532127) integrin, alpha 9
Horse(100054374) integrin, alpha 9
domestic cat(101090796) integrin, alpha 9
dog(477021) integrin, alpha 9
chicken(420757) integrin, alpha 9
domestic guinea pig(100716659) integrin, alpha 9
naked mole-rat(101717104) integrin, alpha 9
sheep(101109832) integrin, alpha 9
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002207 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002207 Rosetta Predictions human pricing
XM_001061864 Rosetta Predictions rat pricing
NM_001113514 Rosetta Predictions mouse pricing
NM_133721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149444 predicted 2566
2 SASI_Hs01_00149445 predicted 1512
3 SASI_Hs01_00149446 predicted 1277
4 SASI_Hs01_00149447 predicted 249
5 SASI_Hs01_00149448 predicted 1749
6 SASI_Hs02_00333429 predicted 2424
7 SASI_Hs01_00149449 predicted 1319
8 SASI_Hs01_00149450 predicted 1058
9 SASI_Hs01_00149451 predicted 901
10 SASI_Hs01_00149452 predicted 2298
11 SASI_Hs01_00149453 predicted 2027
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00301564 predicted 2891
2 SASI_Rn02_00301565 predicted 943
3 SASI_Rn02_00301566 predicted 2020
4 SASI_Rn02_00301567 predicted 1600
5 SASI_Rn02_00301568 predicted 320
6 SASI_Rn02_00301569 predicted 1575
7 SASI_Rn02_00301570 predicted 3158
8 SASI_Rn02_00301571 predicted 1461
9 SASI_Rn02_00301572 predicted 1238
10 SASI_Rn02_00301573 predicted 1182
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308023 predicted 983
2 SASI_Mm02_00308024 predicted 605
3 SASI_Mm02_00308025 predicted 1110
4 SASI_Mm02_00308026 predicted 416
5 SASI_Mm02_00308027 predicted 1206
6 SASI_Mm02_00308028 predicted 1338
7 SASI_Mm02_00308029 predicted 952
8 SASI_Mm02_00308030 predicted 1454
9 SASI_Mm02_00308031 predicted 764
10 SASI_Mm02_00308032 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338692 predicted 2427
2 SASI_Mm02_00338693 predicted 2924
3 SASI_Mm02_00338694 predicted 2233
4 SASI_Mm01_00099583 predicted 3027
5 SASI_Mm02_00338695 predicted 3156
6 SASI_Mm02_00338696 predicted 2776
7 SASI_Mm02_00338697 predicted 3284
8 SASI_Mm02_00338698 predicted 2587
9 SASI_Mm02_00338699 predicted 2968
10 SASI_Mm02_00338700 predicted 3246
11 SASI_Mm01_00099575 predicted 1493
12 SASI_Mm01_00099576 predicted 690
13 SASI_Mm01_00099577 predicted 880
14 SASI_Mm01_00099578 predicted 937
15 SASI_Mm01_00099579 predicted 952
16 SASI_Mm01_00099580 predicted 671
17 SASI_Mm01_00099581 predicted 1089
18 SASI_Mm01_00099582 predicted 927
19 SASI_Mm01_00099584 predicted 1392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002207
ITGA9 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 9
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000057739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002207.2-3077s1c1
Sequence:CCGGCCGAAGGTACAAAGAAATTATCTCGAGATAATTTCTTTGTACCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002207.2-486s1c1
Sequence:CCGGCGCTGGAAGAACATCTACTATCTCGAGATAGTAGATGTTCTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002207.2-2004s1c1
Sequence:CCGGGCTGTGAAGAACATCTCCCTACTCGAGTAGGGAGATGTTCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002207.2-300s1c1
Sequence:CCGGGCTGTGTTTAAGTGCCGTGTTCTCGAGAACACGGCACTTAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002207
ITGA9 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 9
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000057739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002207.2-3077s1c1
Sequence:CCGGCCGAAGGTACAAAGAAATTATCTCGAGATAATTTCTTTGTACCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002207.2-486s1c1
Sequence:CCGGCGCTGGAAGAACATCTACTATCTCGAGATAGTAGATGTTCTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002207.2-2004s1c1
Sequence:CCGGGCTGTGAAGAACATCTCCCTACTCGAGTAGGGAGATGTTCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002207.2-300s1c1
Sequence:CCGGGCTGTGTTTAAGTGCCGTGTTCTCGAGAACACGGCACTTAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002207
ITGA9 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 9
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000057739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002207.2-3077s1c1
Sequence:CCGGCCGAAGGTACAAAGAAATTATCTCGAGATAATTTCTTTGTACCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002207.2-486s1c1
Sequence:CCGGCGCTGGAAGAACATCTACTATCTCGAGATAGTAGATGTTCTTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002207.2-2004s1c1
Sequence:CCGGGCTGTGAAGAACATCTCCCTACTCGAGTAGGGAGATGTTCTTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002207.2-300s1c1
Sequence:CCGGGCTGTGTTTAAGTGCCGTGTTCTCGAGAACACGGCACTTAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133721
VALIDATED
ITGA9 MISSION shRNA Bacterial Glycerol Stock
integrin, alpha 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133721.1-4261s1c1
Sequence:CCGGGCTGTTACCTTGTGGTATAATCTCGAGATTATACCACAAGGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133721.1-2051s1c1
Sequence:CCGGCCCAGAAGAATCAGACAGTTTCTCGAGAAACTGTCTGATTCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133721.1-1730s1c1
Sequence:CCGGGCAAGAATGTACCAGGAGAAACTCGAGTTTCTCCTGGTACATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133721.1-2964s1c1
Sequence:CCGGCCGCACCATCAACCTATACATCTCGAGATGTATAGGTTGATGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133721.2-2778s21c1
Sequence:CCGGGGGTAACTGCTCTCTACAAAGCTCGAGCTTTGTAGAGAGCAGTTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133721
VALIDATED
ITGA9 MISSION shRNA shRNA Plasmid DNA
integrin, alpha 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133721.1-4261s1c1
Sequence:CCGGGCTGTTACCTTGTGGTATAATCTCGAGATTATACCACAAGGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133721.1-2051s1c1
Sequence:CCGGCCCAGAAGAATCAGACAGTTTCTCGAGAAACTGTCTGATTCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133721.1-1730s1c1
Sequence:CCGGGCAAGAATGTACCAGGAGAAACTCGAGTTTCTCCTGGTACATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133721.1-2964s1c1
Sequence:CCGGCCGCACCATCAACCTATACATCTCGAGATGTATAGGTTGATGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133721.2-2778s21c1
Sequence:CCGGGGGTAACTGCTCTCTACAAAGCTCGAGCTTTGTAGAGAGCAGTTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133721
VALIDATED
ITGA9 MISSION shRNA Lentiviral Transduction Particles
integrin, alpha 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066328    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133721.1-4261s1c1
Sequence:CCGGGCTGTTACCTTGTGGTATAATCTCGAGATTATACCACAAGGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133721.1-2051s1c1
Sequence:CCGGCCCAGAAGAATCAGACAGTTTCTCGAGAAACTGTCTGATTCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133721.1-1730s1c1
Sequence:CCGGGCAAGAATGTACCAGGAGAAACTCGAGTTTCTCCTGGTACATTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133721.1-2964s1c1
Sequence:CCGGCCGCACCATCAACCTATACATCTCGAGATGTATAGGTTGATGGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133721.2-2778s21c1
Sequence:CCGGGGGTAACTGCTCTCTACAAAGCTCGAGCTTTGTAGAGAGCAGTTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks