EMAIL THIS PAGE TO A FRIEND

ITGAD

integrin, alpha D

Synonyms: ADB2 CD11D
UniProtKB ID: Q13349, Q15575, Q15576
Gene ID:
Mouse(381924) integrin, alpha D
Rat(64350) integrin, alpha D
sheep(101105872) integrin, alpha D
domestic guinea pig(100735695) integrin, alpha D
naked mole-rat(101698404) integrin, alpha D
chicken(101748640) integrin, alpha D
chicken(101666768) integrin, alpha D
dog(489930) integrin, alpha D
cow(514056) integrin, alpha D
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029872 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029872 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029872 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005353 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005353 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005353 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005353 Rosetta Predictions human pricing
NM_031691 Rosetta Predictions rat pricing
NM_001029872 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069272 predicted 753
2 SASI_Hs01_00069274 predicted 2887
3 SASI_Hs02_00339437 predicted 2653
4 SASI_Hs01_00069276 predicted 475
5 SASI_Hs01_00069278 predicted 2063
6 SASI_Hs01_00069279 predicted 2812
7 SASI_Hs02_00339438 predicted 502
8 SASI_Hs01_00069280 predicted 3331
9 SASI_Hs01_00069281 predicted 2234
10 SASI_Hs02_00339439 predicted 2882
11 SASI_Hs01_00069273 predicted 3298
12 SASI_Hs01_00069275 predicted 3165
13 SASI_Hs01_00069277 predicted 1252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101274 predicted 2013
2 SASI_Rn01_00101275 predicted 2466
3 SASI_Rn01_00101276 predicted 1018
4 SASI_Rn01_00101277 predicted 2176
5 SASI_Rn01_00101278 predicted 3333
6 SASI_Rn01_00101279 predicted 2605
7 SASI_Rn01_00101280 predicted 2755
8 SASI_Rn02_00265035 predicted 2739
9 SASI_Rn02_00265036 predicted 801
10 SASI_Rn01_00101281 predicted 1850
11 SASI_Rn01_00101273 predicted 751
12 SASI_Rn01_00101282 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029872 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288041 predicted 2430
2 SASI_Mm01_00082700 predicted 3512
3 SASI_Mm01_00082701 predicted 2252
4 SASI_Mm01_00082703 predicted 774
5 SASI_Mm01_00082704 predicted 2745
6 SASI_Mm02_00288042 predicted 3052
7 SASI_Mm01_00082705 predicted 2834
8 SASI_Mm02_00288043 predicted 847
9 SASI_Mm01_00082707 predicted 2011
10 SASI_Mm01_00082708 predicted 733
11 SASI_Mm01_00082702 predicted 1996
12 SASI_Mm01_00082706 predicted 862
13 SASI_Mm01_00082709 predicted 2263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029872
ITGAD MISSION shRNA Bacterial Glycerol Stock
integrin, alpha D
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000110776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029872.1-3303s1c1
Sequence:CCGGGCTAGAAGAATACGTGGTCTACTCGAGTAGACCACGTATTCTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029872.1-850s1c1
Sequence:CCGGGCAGAGAAAGCTGGGATCATTCTCGAGAATGATCCCAGCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029872.1-597s1c1
Sequence:CCGGGCAATACTCAAACATCCTGAACTCGAGTTCAGGATGTTTGAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029872.1-2123s1c1
Sequence:CCGGGCGAAACAATGAAGCTGCTTTCTCGAGAAAGCAGCTTCATTGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029872
ITGAD MISSION shRNA shRNA Plasmid DNA
integrin, alpha D
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000110776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029872.1-3303s1c1
Sequence:CCGGGCTAGAAGAATACGTGGTCTACTCGAGTAGACCACGTATTCTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029872.1-850s1c1
Sequence:CCGGGCAGAGAAAGCTGGGATCATTCTCGAGAATGATCCCAGCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029872.1-597s1c1
Sequence:CCGGGCAATACTCAAACATCCTGAACTCGAGTTCAGGATGTTTGAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029872.1-2123s1c1
Sequence:CCGGGCGAAACAATGAAGCTGCTTTCTCGAGAAAGCAGCTTCATTGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029872
ITGAD MISSION shRNA Lentiviral Transduction Particles
integrin, alpha D
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000110776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029872.1-3303s1c1
Sequence:CCGGGCTAGAAGAATACGTGGTCTACTCGAGTAGACCACGTATTCTTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029872.1-850s1c1
Sequence:CCGGGCAGAGAAAGCTGGGATCATTCTCGAGAATGATCCCAGCTTTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029872.1-597s1c1
Sequence:CCGGGCAATACTCAAACATCCTGAACTCGAGTTCAGGATGTTTGAGTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029872.1-2123s1c1
Sequence:CCGGGCGAAACAATGAAGCTGCTTTCTCGAGAAAGCAGCTTCATTGTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005353
ITGAD MISSION shRNA Bacterial Glycerol Stock
integrin, alpha D
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000149674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005353.2-622s1c1
Sequence:CCGGGTACTCAAACCTCCTGAAGATCTCGAGATCTTCAGGAGGTTTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005353.2-3070s1c1
Sequence:CCGGCCAGATTTCAAGAAGTCCCATCTCGAGATGGGACTTCTTGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005353.2-3602s1c1
Sequence:CCGGCATGGAAACAACTTCTGCATACTCGAGTATGCAGAAGTTGTTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005353.2-3666s1c1
Sequence:CCGGCTCGGAGAGATAGAGATTGTACTCGAGTACAATCTCTATCTCTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005353
ITGAD MISSION shRNA shRNA Plasmid DNA
integrin, alpha D
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000149674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005353.2-622s1c1
Sequence:CCGGGTACTCAAACCTCCTGAAGATCTCGAGATCTTCAGGAGGTTTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005353.2-3070s1c1
Sequence:CCGGCCAGATTTCAAGAAGTCCCATCTCGAGATGGGACTTCTTGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005353.2-3602s1c1
Sequence:CCGGCATGGAAACAACTTCTGCATACTCGAGTATGCAGAAGTTGTTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005353.2-3666s1c1
Sequence:CCGGCTCGGAGAGATAGAGATTGTACTCGAGTACAATCTCTATCTCTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005353
ITGAD MISSION shRNA Lentiviral Transduction Particles
integrin, alpha D
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000149674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005353.2-622s1c1
Sequence:CCGGGTACTCAAACCTCCTGAAGATCTCGAGATCTTCAGGAGGTTTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005353.2-3070s1c1
Sequence:CCGGCCAGATTTCAAGAAGTCCCATCTCGAGATGGGACTTCTTGAAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005353.2-3602s1c1
Sequence:CCGGCATGGAAACAACTTCTGCATACTCGAGTATGCAGAAGTTGTTTCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005353.2-3666s1c1
Sequence:CCGGCTCGGAGAGATAGAGATTGTACTCGAGTACAATCTCTATCTCTCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks