EMAIL THIS PAGE TO A FRIEND

ITGBL1

integrin, beta-like 1 (with EGF-like repeat domains)

Synonyms: OSCP TIED
UniProtKB ID: O95965, A8K5M5, Q8N172, Q9NPR0
Gene ID:
Human(9358) Summary: This gene encodes a beta integrin-related protein that is a member of the EGF-like protein family. The encoded protein contains integrin-like cysteine-rich repeats. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(223272) integrin, beta-like 1
Rat(498564) integrin, beta-like 1
domestic guinea pig(100721560) integrin, beta-like 1 (with EGF-like repeat domains)
naked mole-rat(101702594) integrin, beta-like 1 (with EGF-like repeat domains)
sheep(101112990) integrin, beta-like 1 (with EGF-like repeat domains)
Zebrafish(554050) integrin, beta-like 1
domestic cat(101081860) integrin, beta-like 1 (with EGF-like repeat domains)
cow(533449) integrin, beta-like 1 (with EGF-like repeat domains)
Horse(100062835) integrin, beta-like 1 (with EGF-like repeat domains)
dog(485536) integrin, beta-like 1 (with EGF-like repeat domains)
chicken(418769) integrin, beta-like 1 (with EGF-like repeat domains)
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145467 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145467 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145467 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004791 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004791 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004791 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004791 Rosetta Predictions human pricing
NM_001017505 Rosetta Predictions rat pricing
NM_145467 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004791 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225105 predicted 269
2 SASI_Hs01_00225106 predicted 1593
3 SASI_Hs01_00225107 predicted 631
4 SASI_Hs01_00225109 predicted 947
5 SASI_Hs01_00225110 predicted 637
6 SASI_Hs01_00225111 predicted 1594
7 SASI_Hs01_00225112 predicted 1046
8 SASI_Hs01_00225113 predicted 1408
9 SASI_Hs01_00225114 predicted 1295
10 SASI_Hs02_00338311 predicted 1498
11 SASI_Hs01_00225108 predicted 1617
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121635 predicted 413
2 SASI_Rn01_00121636 predicted 960
3 SASI_Rn01_00121637 predicted 602
4 SASI_Rn01_00121638 predicted 1589
5 SASI_Rn01_00121639 predicted 1631
6 SASI_Rn01_00121640 predicted 1294
7 SASI_Rn02_00202332 predicted 794
8 SASI_Rn01_00121641 predicted 432
9 SASI_Rn02_00202333 predicted 580
10 SASI_Rn02_00202334 predicted 1383
11 SASI_Rn01_00121642 predicted 1262
12 SASI_Rn01_00121643 predicted 938
13 SASI_Rn01_00121644 predicted 1312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116850 predicted 674
2 SASI_Mm01_00116851 predicted 1673
3 SASI_Mm01_00116852 predicted 1539
4 SASI_Mm01_00116853 predicted 764
5 SASI_Mm02_00340864 predicted 1704
6 SASI_Mm01_00116854 predicted 699
7 SASI_Mm01_00116855 predicted 1005
8 SASI_Mm01_00116856 predicted 1333
9 SASI_Mm01_00116857 predicted 655
10 SASI_Mm01_00116858 predicted 1542
11 SASI_Mm01_00116859 predicted 1156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145467
VALIDATED
ITGBL1 MISSION shRNA Bacterial Glycerol Stock
integrin, beta-like 1 (with EGF-like repeat domains)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145467.2-1373s21c1
Sequence:CCGGCGGAAGTGTAATATGACAGAACTCGAGTTCTGTCATATTACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145467.2-1476s21c1
Sequence:CCGGGTTCTGGAGAAGAGTGGTATACTCGAGTATACCACTCTTCTCCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145467.2-1825s21c1
Sequence:CCGGAGAATTGTTCTCCCATAATTACTCGAGTAATTATGGGAGAACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145467.2-236s21c1
Sequence:CCGGGCTGCTCCTCAAAGCTTCTTACTCGAGTAAGAAGCTTTGAGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145467.1-1802s1c1
Sequence:CCGGCCCATAATTAACATAGGTGTTCTCGAGAACACCTATGTTAATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145467.1-1340s1c1
Sequence:CCGGCGGAAGTGTAATATGACAGAACTCGAGTTCTGTCATATTACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145467.1-203s1c1
Sequence:CCGGGCTGCTCCTCAAAGCTTCTTACTCGAGTAAGAAGCTTTGAGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145467.1-1443s1c1
Sequence:CCGGGTTCTGGAGAAGAGTGGTATACTCGAGTATACCACTCTTCTCCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145467.1-964s1c1
Sequence:CCGGCAGAGCTGTTTATGATCGATACTCGAGTATCGATCATAAACAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145467
VALIDATED
ITGBL1 MISSION shRNA shRNA Plasmid DNA
integrin, beta-like 1 (with EGF-like repeat domains)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145467.2-1373s21c1
Sequence:CCGGCGGAAGTGTAATATGACAGAACTCGAGTTCTGTCATATTACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145467.2-1476s21c1
Sequence:CCGGGTTCTGGAGAAGAGTGGTATACTCGAGTATACCACTCTTCTCCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145467.2-1825s21c1
Sequence:CCGGAGAATTGTTCTCCCATAATTACTCGAGTAATTATGGGAGAACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145467.2-236s21c1
Sequence:CCGGGCTGCTCCTCAAAGCTTCTTACTCGAGTAAGAAGCTTTGAGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145467.1-1802s1c1
Sequence:CCGGCCCATAATTAACATAGGTGTTCTCGAGAACACCTATGTTAATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145467.1-1340s1c1
Sequence:CCGGCGGAAGTGTAATATGACAGAACTCGAGTTCTGTCATATTACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145467.1-203s1c1
Sequence:CCGGGCTGCTCCTCAAAGCTTCTTACTCGAGTAAGAAGCTTTGAGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145467.1-1443s1c1
Sequence:CCGGGTTCTGGAGAAGAGTGGTATACTCGAGTATACCACTCTTCTCCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145467.1-964s1c1
Sequence:CCGGCAGAGCTGTTTATGATCGATACTCGAGTATCGATCATAAACAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145467
VALIDATED
ITGBL1 MISSION shRNA Lentiviral Transduction Particles
integrin, beta-like 1 (with EGF-like repeat domains)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145467.2-1373s21c1
Sequence:CCGGCGGAAGTGTAATATGACAGAACTCGAGTTCTGTCATATTACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145467.2-1476s21c1
Sequence:CCGGGTTCTGGAGAAGAGTGGTATACTCGAGTATACCACTCTTCTCCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145467.2-1825s21c1
Sequence:CCGGAGAATTGTTCTCCCATAATTACTCGAGTAATTATGGGAGAACAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145467.2-236s21c1
Sequence:CCGGGCTGCTCCTCAAAGCTTCTTACTCGAGTAAGAAGCTTTGAGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145467.1-1802s1c1
Sequence:CCGGCCCATAATTAACATAGGTGTTCTCGAGAACACCTATGTTAATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145467.1-1340s1c1
Sequence:CCGGCGGAAGTGTAATATGACAGAACTCGAGTTCTGTCATATTACACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145467.1-203s1c1
Sequence:CCGGGCTGCTCCTCAAAGCTTCTTACTCGAGTAAGAAGCTTTGAGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145467.1-1443s1c1
Sequence:CCGGGTTCTGGAGAAGAGTGGTATACTCGAGTATACCACTCTTCTCCAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145467.1-964s1c1
Sequence:CCGGCAGAGCTGTTTATGATCGATACTCGAGTATCGATCATAAACAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004791
ITGBL1 MISSION shRNA Bacterial Glycerol Stock
integrin, beta-like 1 (with EGF-like repeat domains)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004791.1-1837s1c1
Sequence:CCGGCGAATGAAATCCGAGTACCTACTCGAGTAGGTACTCGGATTTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004791.1-1423s1c1
Sequence:CCGGCGGAAGTGTAACATGACGGAACTCGAGTTCCGTCATGTTACACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004791.1-1570s1c1
Sequence:CCGGGATGACAGAGACTGCGACAAACTCGAGTTTGTCGCAGTCTCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004791.1-1051s1c1
Sequence:CCGGGCTGTCTATGACCGATATTCTCTCGAGAGAATATCGGTCATAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004791.1-1049s1c1
Sequence:CCGGGAGCTGTCTATGACCGATATTCTCGAGAATATCGGTCATAGACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004791.1-600s1c1
Sequence:CCGGGTACCCAACTAACTGTGACTTCTCGAGAAGTCACAGTTAGTTGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004791.1-698s1c1
Sequence:CCGGGCAGGTGTAAGTGTGATAATTCTCGAGAATTATCACACTTACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004791.1-767s1c1
Sequence:CCGGGAGAATGCATAGACGATGAAACTCGAGTTTCATCGTCTATGCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004791.1-1585s1c1
Sequence:CCGGGACAAACATGATGGTCTCATTCTCGAGAATGAGACCATCATGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004791
ITGBL1 MISSION shRNA shRNA Plasmid DNA
integrin, beta-like 1 (with EGF-like repeat domains)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004791.1-1837s1c1
Sequence:CCGGCGAATGAAATCCGAGTACCTACTCGAGTAGGTACTCGGATTTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004791.1-1423s1c1
Sequence:CCGGCGGAAGTGTAACATGACGGAACTCGAGTTCCGTCATGTTACACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004791.1-1570s1c1
Sequence:CCGGGATGACAGAGACTGCGACAAACTCGAGTTTGTCGCAGTCTCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004791.1-1051s1c1
Sequence:CCGGGCTGTCTATGACCGATATTCTCTCGAGAGAATATCGGTCATAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004791.1-1049s1c1
Sequence:CCGGGAGCTGTCTATGACCGATATTCTCGAGAATATCGGTCATAGACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004791.1-600s1c1
Sequence:CCGGGTACCCAACTAACTGTGACTTCTCGAGAAGTCACAGTTAGTTGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004791.1-698s1c1
Sequence:CCGGGCAGGTGTAAGTGTGATAATTCTCGAGAATTATCACACTTACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004791.1-767s1c1
Sequence:CCGGGAGAATGCATAGACGATGAAACTCGAGTTTCATCGTCTATGCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004791.1-1585s1c1
Sequence:CCGGGACAAACATGATGGTCTCATTCTCGAGAATGAGACCATCATGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004791
ITGBL1 MISSION shRNA Lentiviral Transduction Particles
integrin, beta-like 1 (with EGF-like repeat domains)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004791.1-1837s1c1
Sequence:CCGGCGAATGAAATCCGAGTACCTACTCGAGTAGGTACTCGGATTTCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004791.1-1423s1c1
Sequence:CCGGCGGAAGTGTAACATGACGGAACTCGAGTTCCGTCATGTTACACTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004791.1-1570s1c1
Sequence:CCGGGATGACAGAGACTGCGACAAACTCGAGTTTGTCGCAGTCTCTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004791.1-1051s1c1
Sequence:CCGGGCTGTCTATGACCGATATTCTCTCGAGAGAATATCGGTCATAGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004791.1-1049s1c1
Sequence:CCGGGAGCTGTCTATGACCGATATTCTCGAGAATATCGGTCATAGACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004791.1-600s1c1
Sequence:CCGGGTACCCAACTAACTGTGACTTCTCGAGAAGTCACAGTTAGTTGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004791.1-698s1c1
Sequence:CCGGGCAGGTGTAAGTGTGATAATTCTCGAGAATTATCACACTTACACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144933    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004791.1-767s1c1
Sequence:CCGGGAGAATGCATAGACGATGAAACTCGAGTTTCATCGTCTATGCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004791.1-1585s1c1
Sequence:CCGGGACAAACATGATGGTCTCATTCTCGAGAATGAGACCATCATGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks