EMAIL THIS PAGE TO A FRIEND

ITIH3

inter-alpha-trypsin inhibitor heavy chain 3

Synonyms: H3P
UniProtKB ID: Q06033, Q3B7H5, Q53F06, Q6LAM2, Q99085
Gene ID:
Human(3699) Summary: The inter-alpha-trypsin inhibitors (ITI) are a family of structurally related plasma serine protease inhibitors involved in extracellular matrix stabilization and in prevention of tumor metastasis. The ITI family contains multiple proteins made up of a light chain (see MIM 176870) and a variable number of heavy chains (Salier et al., 1987 [PubMed 2446322]
Mouse(16426) inter-alpha trypsin inhibitor, heavy chain 3
Rat(50693) inter-alpha trypsin inhibitor, heavy chain 3
sheep(101109217) inter-alpha-trypsin inhibitor heavy chain 3
domestic guinea pig(100727917) inter-alpha-trypsin inhibitor heavy chain 3
naked mole-rat(101723437) inter-alpha-trypsin inhibitor heavy chain 3
Zebrafish(613141) inter-alpha (globulin) inhibitor H3
dog(491368) inter-alpha-trypsin inhibitor heavy chain 3
Horse(100059937) inter-alpha-trypsin inhibitor heavy chain 3
cow(508355) inter-alpha-trypsin inhibitor heavy chain 3
domestic cat(101086886) inter-alpha-trypsin inhibitor heavy chain 3
chicken(415901) inter-alpha-trypsin inhibitor heavy chain 3
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008407 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008407 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008407 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002217 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002217 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002217 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039921 MISSION® esiRNA esiRNA human ITIH3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002217 Rosetta Predictions human pricing
NM_017351 Rosetta Predictions rat pricing
NM_008407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333443 predicted 1995
2 SASI_Hs01_00036036 predicted 877
3 SASI_Hs02_00333444 predicted 2652
4 SASI_Hs01_00036038 predicted 2108
5 SASI_Hs01_00036039 predicted 770
6 SASI_Hs02_00333445 predicted 2145
7 SASI_Hs01_00036040 predicted 773
8 SASI_Hs01_00036041 predicted 719
9 SASI_Hs01_00036042 predicted 526
10 SASI_Hs01_00036044 predicted 696
11 SASI_Hs01_00036037 predicted 2449
12 SASI_Hs01_00036043 predicted 2455
13 SASI_Hs01_00036045 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017351 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063626 predicted 281
2 SASI_Rn01_00063627 predicted 491
3 SASI_Rn01_00063628 predicted 861
4 SASI_Rn01_00063629 predicted 1699
5 SASI_Rn01_00063630 predicted 2157
6 SASI_Rn02_00261838 predicted 462
7 SASI_Rn01_00063631 predicted 1765
8 SASI_Rn01_00063632 predicted 1409
9 SASI_Rn01_00063633 predicted 690
10 SASI_Rn01_00063635 predicted 1288
11 SASI_Rn01_00063634 predicted 2501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313851 predicted 886
2 SASI_Mm01_00120797 predicted 526
3 SASI_Mm01_00120798 predicted 619
4 SASI_Mm02_00313852 predicted 2332
5 SASI_Mm01_00120799 predicted 716
6 SASI_Mm01_00120801 predicted 1434
7 SASI_Mm01_00120802 predicted 1282
8 SASI_Mm01_00120804 predicted 830
9 SASI_Mm01_00120805 predicted 809
10 SASI_Mm01_00120806 predicted 1453
11 SASI_Mm01_00120800 predicted 845
12 SASI_Mm01_00120803 predicted 2118
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008407
ITIH3 MISSION shRNA Bacterial Glycerol Stock
inter-alpha-trypsin inhibitor heavy chain 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-1255s1c1
Sequence:CCGGCCCTTTGTATAACCTGGGTTTCTCGAGAAACCCAGGTTATACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-2245s1c1
Sequence:CCGGGACCGGGCTATCTGTAACAATCTCGAGATTGTTACAGATAGCCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-1691s1c1
Sequence:CCGGCTACTGGAGAAACGCAAGAATCTCGAGATTCTTGCGTTTCTCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-1761s1c1
Sequence:CCGGCCCTCAAGTACCACTTTGTAACTCGAGTTACAAAGTGGTACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-2059s1c1
Sequence:CCGGCGGACAGATCATCGGAGATAACTCGAGTTATCTCCGATGATCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008407
ITIH3 MISSION shRNA shRNA Plasmid DNA
inter-alpha-trypsin inhibitor heavy chain 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-1255s1c1
Sequence:CCGGCCCTTTGTATAACCTGGGTTTCTCGAGAAACCCAGGTTATACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-2245s1c1
Sequence:CCGGGACCGGGCTATCTGTAACAATCTCGAGATTGTTACAGATAGCCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-1691s1c1
Sequence:CCGGCTACTGGAGAAACGCAAGAATCTCGAGATTCTTGCGTTTCTCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-1761s1c1
Sequence:CCGGCCCTCAAGTACCACTTTGTAACTCGAGTTACAAAGTGGTACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-2059s1c1
Sequence:CCGGCGGACAGATCATCGGAGATAACTCGAGTTATCTCCGATGATCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008407
ITIH3 MISSION shRNA Lentiviral Transduction Particles
inter-alpha-trypsin inhibitor heavy chain 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-1255s1c1
Sequence:CCGGCCCTTTGTATAACCTGGGTTTCTCGAGAAACCCAGGTTATACAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-2245s1c1
Sequence:CCGGGACCGGGCTATCTGTAACAATCTCGAGATTGTTACAGATAGCCCGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-1691s1c1
Sequence:CCGGCTACTGGAGAAACGCAAGAATCTCGAGATTCTTGCGTTTCTCCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-1761s1c1
Sequence:CCGGCCCTCAAGTACCACTTTGTAACTCGAGTTACAAAGTGGTACTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008407.1-2059s1c1
Sequence:CCGGCGGACAGATCATCGGAGATAACTCGAGTTATCTCCGATGATCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002217
ITIH3 MISSION shRNA Bacterial Glycerol Stock
inter-alpha-trypsin inhibitor heavy chain 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-1267s1c1
Sequence:CCGGCCCTTGTATAACCTGGGCTTTCTCGAGAAAGCCCAGGTTATACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-1470s1c1
Sequence:CCGGCCAGAACACTTACCAGCACTTCTCGAGAAGTGCTGGTAAGTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-692s1c1
Sequence:CCGGGCTTAGACCAACAGCGTTCATCTCGAGATGAACGCTGTTGGTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-2064s1c1
Sequence:CCGGCCTCACAGTTAATGGGCAGATCTCGAGATCTGCCCATTAACTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-226s1c1
Sequence:CCGGGCCAAGGAGGTTTCCTTTGATCTCGAGATCAAAGGAAACCTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002217.3-557s21c1
Sequence:CCGGAGCCTAAGCAACTGGTCAAACCTCGAGGTTTGACCAGTTGCTTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002217.3-1674s21c1
Sequence:CCGGGGACTACATCTTCGGGAATTACTCGAGTAATTCCCGAAGATGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002217
ITIH3 MISSION shRNA shRNA Plasmid DNA
inter-alpha-trypsin inhibitor heavy chain 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-1267s1c1
Sequence:CCGGCCCTTGTATAACCTGGGCTTTCTCGAGAAAGCCCAGGTTATACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-1470s1c1
Sequence:CCGGCCAGAACACTTACCAGCACTTCTCGAGAAGTGCTGGTAAGTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-692s1c1
Sequence:CCGGGCTTAGACCAACAGCGTTCATCTCGAGATGAACGCTGTTGGTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-2064s1c1
Sequence:CCGGCCTCACAGTTAATGGGCAGATCTCGAGATCTGCCCATTAACTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-226s1c1
Sequence:CCGGGCCAAGGAGGTTTCCTTTGATCTCGAGATCAAAGGAAACCTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002217.3-557s21c1
Sequence:CCGGAGCCTAAGCAACTGGTCAAACCTCGAGGTTTGACCAGTTGCTTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002217.3-1674s21c1
Sequence:CCGGGGACTACATCTTCGGGAATTACTCGAGTAATTCCCGAAGATGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002217
ITIH3 MISSION shRNA Lentiviral Transduction Particles
inter-alpha-trypsin inhibitor heavy chain 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-1267s1c1
Sequence:CCGGCCCTTGTATAACCTGGGCTTTCTCGAGAAAGCCCAGGTTATACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-1470s1c1
Sequence:CCGGCCAGAACACTTACCAGCACTTCTCGAGAAGTGCTGGTAAGTGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-692s1c1
Sequence:CCGGGCTTAGACCAACAGCGTTCATCTCGAGATGAACGCTGTTGGTCTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-2064s1c1
Sequence:CCGGCCTCACAGTTAATGGGCAGATCTCGAGATCTGCCCATTAACTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002217.2-226s1c1
Sequence:CCGGGCCAAGGAGGTTTCCTTTGATCTCGAGATCAAAGGAAACCTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002217.3-557s21c1
Sequence:CCGGAGCCTAAGCAACTGGTCAAACCTCGAGGTTTGACCAGTTGCTTAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002217.3-1674s21c1
Sequence:CCGGGGACTACATCTTCGGGAATTACTCGAGTAATTCCCGAAGATGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks