EMAIL THIS PAGE TO A FRIEND

IWS1

IWS1 homolog (S. cerevisiae)

Gene ID:
Mouse(73473) IWS1 homolog (S. cerevisiae)
Rat(291705) IWS1 homolog (S. cerevisiae)
Thale Cress(840105) transcription elongation factor (TFIIS) family protein
dog(476103) IWS1 homolog (S. cerevisiae)
Horse(100146526) IWS1 homolog (S. cerevisiae)
cow(538614) IWS1 homolog (S. cerevisiae)
domestic cat(101093703) IWS1 homolog (S. cerevisiae)
chicken(424750) IWS1 homolog (S. cerevisiae)
domestic guinea pig(100718353) IWS1 homolog (S. cerevisiae)
naked mole-rat(101697657) IWS1 homolog (S. cerevisiae)
Goat(100861142) IWS1 homolog (S. cerevisiae)
sheep(101109331) IWS1 homolog (S. cerevisiae)
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173441 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173441 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173441 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017969 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU022811 MISSION® esiRNA esiRNA targeting mouse Iws1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017969 Rosetta Predictions human pricing
NM_001034918 Rosetta Predictions rat pricing
NM_173441 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153175 predicted 1628
2 SASI_Hs01_00153176 predicted 873
3 SASI_Hs01_00153177 predicted 2533
4 SASI_Hs01_00153178 predicted 2048
5 SASI_Hs01_00153179 predicted 1284
6 SASI_Hs01_00153180 predicted 1069
7 SASI_Hs01_00153181 predicted 2133
8 SASI_Hs01_00153182 predicted 2234
9 SASI_Hs01_00153183 predicted 1684
10 SASI_Hs01_00153184 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034918 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033771 predicted 1848
2 SASI_Rn01_00033772 predicted 1779
3 SASI_Rn01_00033773 predicted 1535
4 SASI_Rn01_00033776 predicted 1296
5 SASI_Rn01_00033777 predicted 1232
6 SASI_Rn01_00033778 predicted 1898
7 SASI_Rn01_00033779 predicted 389
8 SASI_Rn02_00204057 predicted 2075
9 SASI_Rn01_00033780 predicted 1005
10 SASI_Rn02_00204058 predicted 619
11 SASI_Rn01_00033774 predicted 843
12 SASI_Rn01_00033775 predicted 2062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173441 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172996 predicted 417
2 SASI_Mm01_00172997 predicted 806
3 SASI_Mm01_00172998 predicted 506
4 SASI_Mm01_00173000 predicted 2087
5 SASI_Mm01_00173001 predicted 411
6 SASI_Mm01_00173002 predicted 2000
7 SASI_Mm01_00173003 predicted 1996
8 SASI_Mm01_00173004 predicted 2189
9 SASI_Mm01_00173005 predicted 483
10 SASI_Mm02_00345338 predicted 2384
11 SASI_Mm01_00172999 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173441
VALIDATED
IWS1 MISSION shRNA Bacterial Glycerol Stock
IWS1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-1768s1c1
Sequence:CCGGGCCATGATTGTCAAGATGAATCTCGAGATTCATCTTGACAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-2059s1c1
Sequence:CCGGCGAGCAGTGATGTATCTGTATCTCGAGATACAGATACATCACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-2353s1c1
Sequence:CCGGCCATCAAACAAGGACTATGTTCTCGAGAACATAGTCCTTGTTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-1767s1c1
Sequence:CCGGCGCCATGATTGTCAAGATGAACTCGAGTTCATCTTGACAATCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-1984s1c1
Sequence:CCGGCGGGAGGAATTGTTAAAGATTCTCGAGAATCTTTAACAATTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173441
VALIDATED
IWS1 MISSION shRNA shRNA Plasmid DNA
IWS1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-1768s1c1
Sequence:CCGGGCCATGATTGTCAAGATGAATCTCGAGATTCATCTTGACAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-2059s1c1
Sequence:CCGGCGAGCAGTGATGTATCTGTATCTCGAGATACAGATACATCACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-2353s1c1
Sequence:CCGGCCATCAAACAAGGACTATGTTCTCGAGAACATAGTCCTTGTTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-1767s1c1
Sequence:CCGGCGCCATGATTGTCAAGATGAACTCGAGTTCATCTTGACAATCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-1984s1c1
Sequence:CCGGCGGGAGGAATTGTTAAAGATTCTCGAGAATCTTTAACAATTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173441
VALIDATED
IWS1 MISSION shRNA Lentiviral Transduction Particles
IWS1 homolog (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-1768s1c1
Sequence:CCGGGCCATGATTGTCAAGATGAATCTCGAGATTCATCTTGACAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-2059s1c1
Sequence:CCGGCGAGCAGTGATGTATCTGTATCTCGAGATACAGATACATCACTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-2353s1c1
Sequence:CCGGCCATCAAACAAGGACTATGTTCTCGAGAACATAGTCCTTGTTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-1767s1c1
Sequence:CCGGCGCCATGATTGTCAAGATGAACTCGAGTTCATCTTGACAATCATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173441.1-1984s1c1
Sequence:CCGGCGGGAGGAATTGTTAAAGATTCTCGAGAATCTTTAACAATTCCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017969
VALIDATED
IWS1 MISSION shRNA Bacterial Glycerol Stock
IWS1 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017969.1-1072s1c1
Sequence:CCGGCCCGAATCAGTGATTCGGAAACTCGAGTTTCCGAATCACTGATTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017969.1-468s1c1
Sequence:CCGGGAGAACGATGAGCCCTTAAATCTCGAGATTTAAGGGCTCATCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017969.1-1443s1c1
Sequence:CCGGGCTGTGCTTTCTGATAGTGAACTCGAGTTCACTATCAGAAAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161316    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017969.1-2762s1c1
Sequence:CCGGGCAATGGACTCTTTGGAGAAACTCGAGTTTCTCCAAAGAGTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017969.1-876s1c1
Sequence:CCGGCCTCGAATGAGTGATTCTGAACTCGAGTTCAGAATCACTCATTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017969.1-2403s1c1
Sequence:CCGGCGACGAAGAATGAACAGCACTCTCGAGAGTGCTGTTCATTCTTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017969.1-2761s1c1
Sequence:CCGGCGCAATGGACTCTTTGGAGAACTCGAGTTCTCCAAAGAGTCCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-2160s21c1
Sequence:CCGGGCTCTCACCTCTACCAGATAGCTCGAGCTATCTGGTAGAGGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-385s21c1
Sequence:CCGGGACGGTGAGGATGATGTAAATCTCGAGATTTACATCATCCTCACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-2352s21c1
Sequence:CCGGTGAGTGGTCTAGGCCTATATTCTCGAGAATATAGGCCTAGACCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-429s21c1
Sequence:CCGGTGGAAGTGTAGAACGTCATTCCTCGAGGAATGACGTTCTACACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-2437s21c1
Sequence:CCGGATGCCTCAACGACGAAGAATGCTCGAGCATTCTTCGTCGTTGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017969
VALIDATED
IWS1 MISSION shRNA shRNA Plasmid DNA
IWS1 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017969.1-1072s1c1
Sequence:CCGGCCCGAATCAGTGATTCGGAAACTCGAGTTTCCGAATCACTGATTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017969.1-468s1c1
Sequence:CCGGGAGAACGATGAGCCCTTAAATCTCGAGATTTAAGGGCTCATCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017969.1-1443s1c1
Sequence:CCGGGCTGTGCTTTCTGATAGTGAACTCGAGTTCACTATCAGAAAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161316    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017969.1-2762s1c1
Sequence:CCGGGCAATGGACTCTTTGGAGAAACTCGAGTTTCTCCAAAGAGTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017969.1-876s1c1
Sequence:CCGGCCTCGAATGAGTGATTCTGAACTCGAGTTCAGAATCACTCATTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017969.1-2403s1c1
Sequence:CCGGCGACGAAGAATGAACAGCACTCTCGAGAGTGCTGTTCATTCTTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017969.1-2761s1c1
Sequence:CCGGCGCAATGGACTCTTTGGAGAACTCGAGTTCTCCAAAGAGTCCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-2160s21c1
Sequence:CCGGGCTCTCACCTCTACCAGATAGCTCGAGCTATCTGGTAGAGGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-385s21c1
Sequence:CCGGGACGGTGAGGATGATGTAAATCTCGAGATTTACATCATCCTCACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-2352s21c1
Sequence:CCGGTGAGTGGTCTAGGCCTATATTCTCGAGAATATAGGCCTAGACCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-429s21c1
Sequence:CCGGTGGAAGTGTAGAACGTCATTCCTCGAGGAATGACGTTCTACACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-2437s21c1
Sequence:CCGGATGCCTCAACGACGAAGAATGCTCGAGCATTCTTCGTCGTTGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017969
VALIDATED
IWS1 MISSION shRNA Lentiviral Transduction Particles
IWS1 homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017969.1-1072s1c1
Sequence:CCGGCCCGAATCAGTGATTCGGAAACTCGAGTTTCCGAATCACTGATTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017969.1-468s1c1
Sequence:CCGGGAGAACGATGAGCCCTTAAATCTCGAGATTTAAGGGCTCATCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017969.1-1443s1c1
Sequence:CCGGGCTGTGCTTTCTGATAGTGAACTCGAGTTCACTATCAGAAAGCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161316    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017969.1-2762s1c1
Sequence:CCGGGCAATGGACTCTTTGGAGAAACTCGAGTTTCTCCAAAGAGTCCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017969.1-876s1c1
Sequence:CCGGCCTCGAATGAGTGATTCTGAACTCGAGTTCAGAATCACTCATTCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017969.1-2403s1c1
Sequence:CCGGCGACGAAGAATGAACAGCACTCTCGAGAGTGCTGTTCATTCTTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164040    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_017969.1-2761s1c1
Sequence:CCGGCGCAATGGACTCTTTGGAGAACTCGAGTTCTCCAAAGAGTCCATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-2160s21c1
Sequence:CCGGGCTCTCACCTCTACCAGATAGCTCGAGCTATCTGGTAGAGGTGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-385s21c1
Sequence:CCGGGACGGTGAGGATGATGTAAATCTCGAGATTTACATCATCCTCACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-2352s21c1
Sequence:CCGGTGAGTGGTCTAGGCCTATATTCTCGAGAATATAGGCCTAGACCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-429s21c1
Sequence:CCGGTGGAAGTGTAGAACGTCATTCCTCGAGGAATGACGTTCTACACTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017969.2-2437s21c1
Sequence:CCGGATGCCTCAACGACGAAGAATGCTCGAGCATTCTTCGTCGTTGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks