EMAIL THIS PAGE TO A FRIEND

IYD

iodotyrosine deiodinase

Synonyms: C6orf71 DEHAL1 TDH4 dJ422F24.1
Gene ID:
Human(389434) Summary: This gene encodes an enzyme that catalyzes the oxidative NADPH-dependent deiodination of mono- and diiodotyrosine, which are the halogenated byproducts of thyroid hormone production. The N-terminus of the protein functions as a membrane anchor. Mutations in this gene cause congenital hypothyroidism due to dyshormonogenesis type 4, which is also referred to as deiodinase deficiency, or iodotyrosine dehalogenase deficiency, or thyroid hormonogenesis type 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Mouse(70337) iodotyrosine deiodinase
Rat(308129) iodotyrosine deiodinase
Zebrafish(568107) iodotyrosine deiodinase
cow(534110) iodotyrosine deiodinase
domestic cat(101100136) iodotyrosine deiodinase
dog(476244) iodotyrosine deiodinase
chicken(421631) iodotyrosine deiodinase
sheep(101123564) iodotyrosine deiodinase
domestic guinea pig(100728406) iodotyrosine deiodinase
naked mole-rat(101721889) iodotyrosine deiodinase
241 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203395 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027391 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027391 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027391 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203395 Rosetta Predictions human pricing
NM_001025000 Rosetta Predictions rat pricing
NM_027391 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069572 predicted 732
2 SASI_Hs01_00069573 predicted 669
3 SASI_Hs01_00069574 predicted 396
4 SASI_Hs01_00069575 predicted 450
5 SASI_Hs01_00069576 predicted 289
6 SASI_Hs01_00069577 predicted 784
7 SASI_Hs01_00069578 predicted 630
8 SASI_Hs01_00069579 predicted 842
9 SASI_Hs01_00069580 predicted 736
10 SASI_Hs01_00069581 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075420 predicted 839
2 SASI_Rn01_00075421 predicted 429
3 SASI_Rn01_00075422 predicted 975
4 SASI_Rn01_00075423 predicted 523
5 SASI_Rn01_00075424 predicted 531
6 SASI_Rn01_00075425 predicted 214
7 SASI_Rn01_00075426 predicted 401
8 SASI_Rn01_00075427 predicted 419
9 SASI_Rn01_00075428 predicted 617
10 SASI_Rn01_00075429 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027391 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095391 predicted 525
2 SASI_Mm02_00332099 predicted 1167
3 SASI_Mm01_00095394 predicted 434
4 SASI_Mm02_00332100 predicted 973
5 SASI_Mm01_00095395 predicted 1155
6 SASI_Mm01_00095396 predicted 634
7 SASI_Mm02_00332101 predicted 1025
8 SASI_Mm02_00332102 predicted 986
9 SASI_Mm01_00095399 predicted 942
10 SASI_Mm02_00332103 predicted 618
11 SASI_Mm01_00095392 predicted 541
12 SASI_Mm01_00095393 predicted 1237
13 SASI_Mm01_00095397 predicted 439
14 SASI_Mm01_00095398 predicted 1184
15 SASI_Mm01_00095400 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203395
IYD MISSION shRNA Bacterial Glycerol Stock
iodotyrosine deiodinase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203395.2-1368s21c1
Sequence:CCGGACATGATGACTCGAATTTAAACTCGAGTTTAAATTCGAGTCATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203395.2-1196s21c1
Sequence:CCGGTCCTGTTTCTTATCCACTTTGCTCGAGCAAAGTGGATAAGAAACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203395.2-440s21c1
Sequence:CCGGACGGTCAGTCAGGTTCATAAGCTCGAGCTTATGAACCTGACTGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-567s1c1
Sequence:CCGGCCAGACGTGAAGCACAAGATTCTCGAGAATCTTGTGCTTCACGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-265s1c1
Sequence:CCGGCCTGGGTGGATGAAGACTTAACTCGAGTTAAGTCTTCATCCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-732s1c1
Sequence:CCGGGTACATGGTTTCGCCGCAAATCTCGAGATTTGCGGCGAAACCATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-309s1c1
Sequence:CCGGGCAGAAGAAGATGCTGATGAACTCGAGTTCATCAGCATCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-474s1c1
Sequence:CCGGCCAATGGAAGTCATTGATAATCTCGAGATTATCAATGACTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203395
IYD MISSION shRNA shRNA Plasmid DNA
iodotyrosine deiodinase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203395.2-1368s21c1
Sequence:CCGGACATGATGACTCGAATTTAAACTCGAGTTTAAATTCGAGTCATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203395.2-1196s21c1
Sequence:CCGGTCCTGTTTCTTATCCACTTTGCTCGAGCAAAGTGGATAAGAAACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203395.2-440s21c1
Sequence:CCGGACGGTCAGTCAGGTTCATAAGCTCGAGCTTATGAACCTGACTGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-567s1c1
Sequence:CCGGCCAGACGTGAAGCACAAGATTCTCGAGAATCTTGTGCTTCACGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-265s1c1
Sequence:CCGGCCTGGGTGGATGAAGACTTAACTCGAGTTAAGTCTTCATCCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-732s1c1
Sequence:CCGGGTACATGGTTTCGCCGCAAATCTCGAGATTTGCGGCGAAACCATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-309s1c1
Sequence:CCGGGCAGAAGAAGATGCTGATGAACTCGAGTTCATCAGCATCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-474s1c1
Sequence:CCGGCCAATGGAAGTCATTGATAATCTCGAGATTATCAATGACTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203395
IYD MISSION shRNA Lentiviral Transduction Particles
iodotyrosine deiodinase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203395.2-1368s21c1
Sequence:CCGGACATGATGACTCGAATTTAAACTCGAGTTTAAATTCGAGTCATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_203395.2-1196s21c1
Sequence:CCGGTCCTGTTTCTTATCCACTTTGCTCGAGCAAAGTGGATAAGAAACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203395.2-440s21c1
Sequence:CCGGACGGTCAGTCAGGTTCATAAGCTCGAGCTTATGAACCTGACTGACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-567s1c1
Sequence:CCGGCCAGACGTGAAGCACAAGATTCTCGAGAATCTTGTGCTTCACGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-265s1c1
Sequence:CCGGCCTGGGTGGATGAAGACTTAACTCGAGTTAAGTCTTCATCCACCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-732s1c1
Sequence:CCGGGTACATGGTTTCGCCGCAAATCTCGAGATTTGCGGCGAAACCATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-309s1c1
Sequence:CCGGGCAGAAGAAGATGCTGATGAACTCGAGTTCATCAGCATCTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203395.1-474s1c1
Sequence:CCGGCCAATGGAAGTCATTGATAATCTCGAGATTATCAATGACTTCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027391
VALIDATED
IYD MISSION shRNA Bacterial Glycerol Stock
iodotyrosine deiodinase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027391.3-431s21c1
Sequence:CCGGCCCAGACATGAAGCATAAGATCTCGAGATCTTATGCTTCATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027391.3-58s21c1
Sequence:CCGGTCTTGGTTGTATGGGTCTTTACTCGAGTAAAGACCCATACAACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027391.3-641s21c1
Sequence:CCGGCAACGAGATCAGTGTGTCCATCTCGAGATGGACACACTGATCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027391.3-303s21c1
Sequence:CCGGAGACGCTCCGTCAGGTTTATCCTCGAGGATAAACCTGACGGAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027391.3-1031s21c1
Sequence:CCGGACTTTCAGTCCAGTAAGTTATCTCGAGATAACTTACTGGACTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027391.1-334s1c1
Sequence:CCGGCACGTCCCAATGGAAGTCATTCTCGAGAATGACTTCCATTGGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027391.1-432s1c1
Sequence:CCGGCCCAGACATGAAGCATAAGATCTCGAGATCTTATGCTTCATGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027391.1-642s1c1
Sequence:CCGGCAACGAGATCAGTGTGTCCATCTCGAGATGGACACACTGATCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027391.1-1335s1c1
Sequence:CCGGCAATCTTGAATGAGTGACCTTCTCGAGAAGGTCACTCATTCAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027391.1-441s1c1
Sequence:CCGGGAAGCATAAGATCAGAGAGATCTCGAGATCTCTCTGATCTTATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027391
VALIDATED
IYD MISSION shRNA shRNA Plasmid DNA
iodotyrosine deiodinase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027391.3-431s21c1
Sequence:CCGGCCCAGACATGAAGCATAAGATCTCGAGATCTTATGCTTCATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027391.3-58s21c1
Sequence:CCGGTCTTGGTTGTATGGGTCTTTACTCGAGTAAAGACCCATACAACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027391.3-641s21c1
Sequence:CCGGCAACGAGATCAGTGTGTCCATCTCGAGATGGACACACTGATCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027391.3-303s21c1
Sequence:CCGGAGACGCTCCGTCAGGTTTATCCTCGAGGATAAACCTGACGGAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027391.3-1031s21c1
Sequence:CCGGACTTTCAGTCCAGTAAGTTATCTCGAGATAACTTACTGGACTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027391.1-334s1c1
Sequence:CCGGCACGTCCCAATGGAAGTCATTCTCGAGAATGACTTCCATTGGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027391.1-432s1c1
Sequence:CCGGCCCAGACATGAAGCATAAGATCTCGAGATCTTATGCTTCATGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027391.1-642s1c1
Sequence:CCGGCAACGAGATCAGTGTGTCCATCTCGAGATGGACACACTGATCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027391.1-1335s1c1
Sequence:CCGGCAATCTTGAATGAGTGACCTTCTCGAGAAGGTCACTCATTCAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027391.1-441s1c1
Sequence:CCGGGAAGCATAAGATCAGAGAGATCTCGAGATCTCTCTGATCTTATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027391
VALIDATED
IYD MISSION shRNA Lentiviral Transduction Particles
iodotyrosine deiodinase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027391.3-431s21c1
Sequence:CCGGCCCAGACATGAAGCATAAGATCTCGAGATCTTATGCTTCATGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027391.3-58s21c1
Sequence:CCGGTCTTGGTTGTATGGGTCTTTACTCGAGTAAAGACCCATACAACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027391.3-641s21c1
Sequence:CCGGCAACGAGATCAGTGTGTCCATCTCGAGATGGACACACTGATCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027391.3-303s21c1
Sequence:CCGGAGACGCTCCGTCAGGTTTATCCTCGAGGATAAACCTGACGGAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279387    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027391.3-1031s21c1
Sequence:CCGGACTTTCAGTCCAGTAAGTTATCTCGAGATAACTTACTGGACTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027391.1-334s1c1
Sequence:CCGGCACGTCCCAATGGAAGTCATTCTCGAGAATGACTTCCATTGGGACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027391.1-432s1c1
Sequence:CCGGCCCAGACATGAAGCATAAGATCTCGAGATCTTATGCTTCATGTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027391.1-642s1c1
Sequence:CCGGCAACGAGATCAGTGTGTCCATCTCGAGATGGACACACTGATCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027391.1-1335s1c1
Sequence:CCGGCAATCTTGAATGAGTGACCTTCTCGAGAAGGTCACTCATTCAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027391.1-441s1c1
Sequence:CCGGGAAGCATAAGATCAGAGAGATCTCGAGATCTCTCTGATCTTATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks