EMAIL THIS PAGE TO A FRIEND

JAG2

jagged 2

Synonyms: HJ2 SER2
UniProtKB ID: Q9Y219, Q9UE17, Q9UE99, Q9UNK8, Q9Y6P9, Q9Y6Q0
Gene ID:
Human(3714) Summary: The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16450) jagged 2
Rat(29147) jagged 2
chicken(776138) jagged 2
cow(517405) jagged 2
dog(490882) jagged 2
145 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002226 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002226 Rosetta Predictions human pricing
NM_145159 Rosetta Predictions human pricing
XM_001073124 Rosetta Predictions rat pricing
XM_343119 Rosetta Predictions rat pricing
NM_010588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053720 predicted 2745
2 SASI_Hs01_00053721 predicted 1118
3 SASI_Hs01_00053722 predicted 2465
4 SASI_Hs01_00053724 predicted 2297
5 SASI_Hs02_00333458 predicted 1113
6 SASI_Hs01_00053725 predicted 3317
7 SASI_Hs01_00053726 predicted 2930
8 SASI_Hs01_00053727 predicted 2533
9 SASI_Hs01_00053728 predicted 2989
10 SASI_Hs02_00333459 predicted 1368
11 SASI_Hs01_00053723 predicted 1136
12 SASI_Hs01_00053729 predicted 3642
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181331 predicted 2631
2 SASI_Hs01_00181332 predicted 1119
3 SASI_Hs01_00181333 predicted 2349
4 SASI_Hs01_00181335 predicted 2180
5 SASI_Hs02_00365008 predicted 1117
6 SASI_Hs01_00181336 predicted 3208
7 SASI_Hs01_00181337 predicted 2819
8 SASI_Hs01_00181338 predicted 2426
9 SASI_Hs01_00181339 predicted 2875
10 SASI_Hs02_00365009 predicted 1366
11 SASI_Hs01_00181334 predicted 1129
12 SASI_Hs01_00181340 predicted 3526
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341599 predicted 909
2 SASI_Rn02_00341600 predicted 2257
3 SASI_Rn02_00341601 predicted 3796
4 SASI_Rn02_00341602 predicted 1002
5 SASI_Rn02_00341603 predicted 920
6 SASI_Rn02_00341604 predicted 1880
7 SASI_Rn02_00341605 predicted 2274
8 SASI_Rn02_00341606 predicted 3655
9 SASI_Rn02_00341607 predicted 1510
10 SASI_Rn02_00341608 predicted 3415
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343119 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395343 predicted 725
2 SASI_Rn02_00395344 predicted 2071
3 SASI_Rn02_00395345 predicted 3618
4 SASI_Rn02_00395346 predicted 813
5 SASI_Rn02_00395347 predicted 742
6 SASI_Rn02_00395348 predicted 1695
7 SASI_Rn02_00395349 predicted 2088
8 SASI_Rn02_00395350 predicted 3468
9 SASI_Rn02_00395351 predicted 1328
10 SASI_Rn02_00395352 predicted 3225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021289 predicted 728
2 SASI_Mm01_00021291 predicted 2072
3 SASI_Mm01_00021292 predicted 1369
4 SASI_Mm01_00021293 predicted 1658
5 SASI_Mm01_00021294 predicted 818
6 SASI_Mm01_00021295 predicted 1325
7 SASI_Mm02_00318888 predicted 3233
8 SASI_Mm02_00318889 predicted 1380
9 SASI_Mm01_00021297 predicted 686
10 SASI_Mm01_00021298 predicted 1277
11 SASI_Mm01_00021290 predicted 1397
12 SASI_Mm01_00021296 predicted 1385
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002226
VALIDATED
JAG2 MISSION shRNA Bacterial Glycerol Stock
jagged 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_002226.3-4265s21c1
Sequence:CCGGACGTTTCTTTAACCTTGTATACTCGAGTATACAAGGTTAAAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002226.3-2059s21c1
Sequence:CCGGATAACCTGGAGGGTGACTATTCTCGAGAATAGTCACCCTCCAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002226.3-2752s21c1
Sequence:CCGGGTCGTACTTGCACTCACAATACTCGAGTATTGTGAGTGCAAGTACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002226.3-2296s21c1
Sequence:CCGGCCTACTGCCATGAGAACATTGCTCGAGCAATGTTCTCATGGCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002226.3-4192s21c1
Sequence:CCGGCGAGGCCATGTGCATAGTTTCCTCGAGGAAACTATGCACATGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002226.3-3608s21c1
Sequence:CCGGCAAGGTGGAGACGGTTGTTACCTCGAGGTAACAACCGTCTCCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-3845s1c1
Sequence:CCGGGCTCTACCAGTGCAAGAACTTCTCGAGAAGTTCTTGCACTGGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-1132s1c1
Sequence:CCGGCTGTGTGTAAACAAGGGTGTACTCGAGTACACCCTTGTTTACACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-2466s1c1
Sequence:CCGGCGCTGCTACGACCTGGTCAATCTCGAGATTGACCAGGTCGTAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-1772s1c1
Sequence:CCGGCAACTGCCATATCAACGTCAACTCGAGTTGACGTTGATATGGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-3993s1c1
Sequence:CCGGCTCTCACACAAATTCACCAAACTCGAGTTTGGTGAATTTGTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002226
VALIDATED
JAG2 MISSION shRNA shRNA Plasmid DNA
jagged 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_002226.3-4265s21c1
Sequence:CCGGACGTTTCTTTAACCTTGTATACTCGAGTATACAAGGTTAAAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002226.3-2059s21c1
Sequence:CCGGATAACCTGGAGGGTGACTATTCTCGAGAATAGTCACCCTCCAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002226.3-2752s21c1
Sequence:CCGGGTCGTACTTGCACTCACAATACTCGAGTATTGTGAGTGCAAGTACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002226.3-2296s21c1
Sequence:CCGGCCTACTGCCATGAGAACATTGCTCGAGCAATGTTCTCATGGCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002226.3-4192s21c1
Sequence:CCGGCGAGGCCATGTGCATAGTTTCCTCGAGGAAACTATGCACATGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002226.3-3608s21c1
Sequence:CCGGCAAGGTGGAGACGGTTGTTACCTCGAGGTAACAACCGTCTCCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-3845s1c1
Sequence:CCGGGCTCTACCAGTGCAAGAACTTCTCGAGAAGTTCTTGCACTGGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-1132s1c1
Sequence:CCGGCTGTGTGTAAACAAGGGTGTACTCGAGTACACCCTTGTTTACACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-2466s1c1
Sequence:CCGGCGCTGCTACGACCTGGTCAATCTCGAGATTGACCAGGTCGTAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-1772s1c1
Sequence:CCGGCAACTGCCATATCAACGTCAACTCGAGTTGACGTTGATATGGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-3993s1c1
Sequence:CCGGCTCTCACACAAATTCACCAAACTCGAGTTTGGTGAATTTGTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002226
VALIDATED
JAG2 MISSION shRNA Lentiviral Transduction Particles
jagged 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_002226.3-4265s21c1
Sequence:CCGGACGTTTCTTTAACCTTGTATACTCGAGTATACAAGGTTAAAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002226.3-2059s21c1
Sequence:CCGGATAACCTGGAGGGTGACTATTCTCGAGAATAGTCACCCTCCAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002226.3-2752s21c1
Sequence:CCGGGTCGTACTTGCACTCACAATACTCGAGTATTGTGAGTGCAAGTACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002226.3-2296s21c1
Sequence:CCGGCCTACTGCCATGAGAACATTGCTCGAGCAATGTTCTCATGGCAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002226.3-4192s21c1
Sequence:CCGGCGAGGCCATGTGCATAGTTTCCTCGAGGAAACTATGCACATGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_002226.3-3608s21c1
Sequence:CCGGCAAGGTGGAGACGGTTGTTACCTCGAGGTAACAACCGTCTCCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-3845s1c1
Sequence:CCGGGCTCTACCAGTGCAAGAACTTCTCGAGAAGTTCTTGCACTGGTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-1132s1c1
Sequence:CCGGCTGTGTGTAAACAAGGGTGTACTCGAGTACACCCTTGTTTACACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-2466s1c1
Sequence:CCGGCGCTGCTACGACCTGGTCAATCTCGAGATTGACCAGGTCGTAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-1772s1c1
Sequence:CCGGCAACTGCCATATCAACGTCAACTCGAGTTGACGTTGATATGGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002226.3-3993s1c1
Sequence:CCGGCTCTCACACAAATTCACCAAACTCGAGTTTGGTGAATTTGTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010588
JAG2 MISSION shRNA Bacterial Glycerol Stock
jagged 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010588.2-2476s21c1
Sequence:CCGGCTGACTGCCGTATCAACATTGCTCGAGCAATGTTGATACGGCAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010588.2-655s21c1
Sequence:CCGGACGACTTCTTTGGCCACTATACTCGAGTATAGTGGCCAAAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010588.2-1808s21c1
Sequence:CCGGTGTCGCACCCTCTGGTATATGCTCGAGCATATACCAGAGGGTGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-1384s1c1
Sequence:CCGGGCCAAATCAACATCAACGATTCTCGAGAATCGTTGATGTTGATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-3307s1c1
Sequence:CCGGCCTGTGTGGTTATCTGCGTATCTCGAGATACGCAGATAACCACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-2073s1c1
Sequence:CCGGCGCTGCTATGACCTGGTCAATCTCGAGATTGACCAGGTCATAGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-425s1c1
Sequence:CCGGGCCGCGTTCTTTCACCCTCATCTCGAGATGAGGGTGAAAGAACGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-3171s1c1
Sequence:CCGGGCTATCACTCAGAGAGGAAATCTCGAGATTTCCTCTCTGAGTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010588
JAG2 MISSION shRNA shRNA Plasmid DNA
jagged 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010588.2-2476s21c1
Sequence:CCGGCTGACTGCCGTATCAACATTGCTCGAGCAATGTTGATACGGCAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010588.2-655s21c1
Sequence:CCGGACGACTTCTTTGGCCACTATACTCGAGTATAGTGGCCAAAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010588.2-1808s21c1
Sequence:CCGGTGTCGCACCCTCTGGTATATGCTCGAGCATATACCAGAGGGTGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-1384s1c1
Sequence:CCGGGCCAAATCAACATCAACGATTCTCGAGAATCGTTGATGTTGATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-3307s1c1
Sequence:CCGGCCTGTGTGGTTATCTGCGTATCTCGAGATACGCAGATAACCACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-2073s1c1
Sequence:CCGGCGCTGCTATGACCTGGTCAATCTCGAGATTGACCAGGTCATAGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-425s1c1
Sequence:CCGGGCCGCGTTCTTTCACCCTCATCTCGAGATGAGGGTGAAAGAACGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-3171s1c1
Sequence:CCGGGCTATCACTCAGAGAGGAAATCTCGAGATTTCCTCTCTGAGTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010588
JAG2 MISSION shRNA Lentiviral Transduction Particles
jagged 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010588.2-2476s21c1
Sequence:CCGGCTGACTGCCGTATCAACATTGCTCGAGCAATGTTGATACGGCAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010588.2-655s21c1
Sequence:CCGGACGACTTCTTTGGCCACTATACTCGAGTATAGTGGCCAAAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010588.2-1808s21c1
Sequence:CCGGTGTCGCACCCTCTGGTATATGCTCGAGCATATACCAGAGGGTGCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-1384s1c1
Sequence:CCGGGCCAAATCAACATCAACGATTCTCGAGAATCGTTGATGTTGATTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-3307s1c1
Sequence:CCGGCCTGTGTGGTTATCTGCGTATCTCGAGATACGCAGATAACCACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-2073s1c1
Sequence:CCGGCGCTGCTATGACCTGGTCAATCTCGAGATTGACCAGGTCATAGCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-425s1c1
Sequence:CCGGGCCGCGTTCTTTCACCCTCATCTCGAGATGAGGGTGAAAGAACGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010588.1-3171s1c1
Sequence:CCGGGCTATCACTCAGAGAGGAAATCTCGAGATTTCCTCTCTGAGTGATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks