EMAIL THIS PAGE TO A FRIEND

JAGN1

jagunal homolog 1 (Drosophila)

Synonyms: GL009
UniProtKB ID: Q8N5M9, Q8NCF6, Q96SW1
Gene ID:
Mouse(67767) jagunal homolog 1 (Drosophila)
Rat(502872) jagunal homolog 1 (Drosophila)
domestic cat(101085870) jagunal homolog 1 (Drosophila)
cow(539101) jagunal homolog 1 (Drosophila)
dog(484661) jagunal homolog 1 (Drosophila)
sheep(101102095) jagunal homolog 1 (Drosophila)
domestic guinea pig(100718646) jagunal homolog 1 (Drosophila)
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032492 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032492 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032492 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032492 Rosetta Predictions human pricing
NM_001044272 Rosetta Predictions rat pricing
XM_578373 Rosetta Predictions rat pricing
NM_026365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065560 predicted 223
2 SASI_Hs01_00065561 predicted 1000
3 SASI_Hs01_00065564 predicted 829
4 SASI_Hs01_00065565 predicted 256
5 SASI_Hs01_00065566 predicted 358
6 SASI_Hs01_00065567 predicted 901
7 SASI_Hs01_00065568 predicted 871
8 SASI_Hs01_00065569 predicted 215
9 SASI_Hs02_00359960 predicted 211
10 SASI_Hs02_00359961 predicted 945
11 SASI_Hs01_00065562 predicted 886
12 SASI_Hs01_00065563 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044272 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205394 predicted 872
2 SASI_Rn02_00205395 predicted 923
3 SASI_Rn02_00205396 predicted 308
4 SASI_Rn02_00205397 predicted 628
5 SASI_Rn02_00205398 predicted 895
6 SASI_Rn02_00205399 predicted 640
7 SASI_Rn02_00205400 predicted 760
8 SASI_Rn02_00205401 predicted 212
9 SASI_Rn02_00205402 predicted 771
10 SASI_Rn02_00205403 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578373 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126851 predicted 210
2 SASI_Rn01_00126852 predicted 71
3 SASI_Rn01_00126853 predicted 73
4 SASI_Rn01_00126854 predicted 58
5 SASI_Rn01_00126855 predicted 30
6 SASI_Rn01_00126856 predicted 25
7 SASI_Rn01_00126857 predicted 62
8 SASI_Rn01_00126858 predicted 28
9 SASI_Rn01_00126859 predicted 58
10 SASI_Rn01_00126860 predicted 187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070833 predicted 845
2 SASI_Mm01_00070834 predicted 700
3 SASI_Mm01_00070835 predicted 835
4 SASI_Mm01_00070836 predicted 348
5 SASI_Mm02_00330084 predicted 907
6 SASI_Mm01_00070838 predicted 518
7 SASI_Mm01_00070839 predicted 757
8 SASI_Mm01_00070840 predicted 896
9 SASI_Mm01_00070841 predicted 657
10 SASI_Mm01_00070842 predicted 679
11 SASI_Mm01_00070837 predicted 792
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032492
JAGN1 MISSION shRNA Bacterial Glycerol Stock
jagunal homolog 1 (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032492.2-1350s1c1
Sequence:CCGGCCAGACATTTAATCTCTCCATCTCGAGATGGAGAGATTAAATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032492.2-540s1c1
Sequence:CCGGCTACCGTTTCCTCTTTGGTTTCTCGAGAAACCAAAGAGGAAACGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032492.2-636s1c1
Sequence:CCGGGAAGCTCCTAGACTCTTGGTTCTCGAGAACCAAGAGTCTAGGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032492.2-444s1c1
Sequence:CCGGCATGATCAGCATGGGACTCTTCTCGAGAAGAGTCCCATGCTGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032492.2-342s1c1
Sequence:CCGGCATGCCCTATCAGTGGGAATACTCGAGTATTCCCACTGATAGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032492.2-716s1c1
Sequence:CCGGCCATCGAATGAAAGGACACTACTCGAGTAGTGTCCTTTCATTCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032492.2-539s1c1
Sequence:CCGGCCTACCGTTTCCTCTTTGGTTCTCGAGAACCAAAGAGGAAACGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032492
JAGN1 MISSION shRNA shRNA Plasmid DNA
jagunal homolog 1 (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032492.2-1350s1c1
Sequence:CCGGCCAGACATTTAATCTCTCCATCTCGAGATGGAGAGATTAAATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032492.2-540s1c1
Sequence:CCGGCTACCGTTTCCTCTTTGGTTTCTCGAGAAACCAAAGAGGAAACGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032492.2-636s1c1
Sequence:CCGGGAAGCTCCTAGACTCTTGGTTCTCGAGAACCAAGAGTCTAGGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032492.2-444s1c1
Sequence:CCGGCATGATCAGCATGGGACTCTTCTCGAGAAGAGTCCCATGCTGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032492.2-342s1c1
Sequence:CCGGCATGCCCTATCAGTGGGAATACTCGAGTATTCCCACTGATAGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032492.2-716s1c1
Sequence:CCGGCCATCGAATGAAAGGACACTACTCGAGTAGTGTCCTTTCATTCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032492.2-539s1c1
Sequence:CCGGCCTACCGTTTCCTCTTTGGTTCTCGAGAACCAAAGAGGAAACGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032492
JAGN1 MISSION shRNA Lentiviral Transduction Particles
jagunal homolog 1 (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032492.2-1350s1c1
Sequence:CCGGCCAGACATTTAATCTCTCCATCTCGAGATGGAGAGATTAAATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032492.2-540s1c1
Sequence:CCGGCTACCGTTTCCTCTTTGGTTTCTCGAGAAACCAAAGAGGAAACGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032492.2-636s1c1
Sequence:CCGGGAAGCTCCTAGACTCTTGGTTCTCGAGAACCAAGAGTCTAGGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139824    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032492.2-444s1c1
Sequence:CCGGCATGATCAGCATGGGACTCTTCTCGAGAAGAGTCCCATGCTGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032492.2-342s1c1
Sequence:CCGGCATGCCCTATCAGTGGGAATACTCGAGTATTCCCACTGATAGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142925    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032492.2-716s1c1
Sequence:CCGGCCATCGAATGAAAGGACACTACTCGAGTAGTGTCCTTTCATTCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032492.2-539s1c1
Sequence:CCGGCCTACCGTTTCCTCTTTGGTTCTCGAGAACCAAAGAGGAAACGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026365
VALIDATED
JAGN1 MISSION shRNA Bacterial Glycerol Stock
jagunal homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026365.1-417s1c1
Sequence:CCGGCCTCATTTATGGCAGCATGGACTCGAGTCCATGCTGCCATAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026365.1-159s1c1
Sequence:CCGGGATGAGTGTGACCCTCAAGTACTCGAGTACTTGAGGGTCACACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026365.1-910s1c1
Sequence:CCGGGCCTTATCCTTGCCTTCTCTTCTCGAGAAGAGAAGGCAAGGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026365.1-177s1c1
Sequence:CCGGGTACGAAATCAAGAAGCTGATCTCGAGATCAGCTTCTTGATTTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026365.2-176s21c1
Sequence:CCGGGTACGAAATCAAGAAGCTGATCTCGAGATCAGCTTCTTGATTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026365.2-158s21c1
Sequence:CCGGGATGAGTGTGACCCTCAAGTACTCGAGTACTTGAGGGTCACACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026365.2-909s21c1
Sequence:CCGGGCCTTATCCTTGCCTTCTCTTCTCGAGAAGAGAAGGCAAGGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026365.2-291s21c1
Sequence:CCGGCAGTGGGAATATCCGTATTTGCTCGAGCAAATACGGATATTCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026365
VALIDATED
JAGN1 MISSION shRNA shRNA Plasmid DNA
jagunal homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026365.1-417s1c1
Sequence:CCGGCCTCATTTATGGCAGCATGGACTCGAGTCCATGCTGCCATAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026365.1-159s1c1
Sequence:CCGGGATGAGTGTGACCCTCAAGTACTCGAGTACTTGAGGGTCACACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026365.1-910s1c1
Sequence:CCGGGCCTTATCCTTGCCTTCTCTTCTCGAGAAGAGAAGGCAAGGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026365.1-177s1c1
Sequence:CCGGGTACGAAATCAAGAAGCTGATCTCGAGATCAGCTTCTTGATTTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026365.2-176s21c1
Sequence:CCGGGTACGAAATCAAGAAGCTGATCTCGAGATCAGCTTCTTGATTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026365.2-158s21c1
Sequence:CCGGGATGAGTGTGACCCTCAAGTACTCGAGTACTTGAGGGTCACACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026365.2-909s21c1
Sequence:CCGGGCCTTATCCTTGCCTTCTCTTCTCGAGAAGAGAAGGCAAGGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026365.2-291s21c1
Sequence:CCGGCAGTGGGAATATCCGTATTTGCTCGAGCAAATACGGATATTCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026365
VALIDATED
JAGN1 MISSION shRNA Lentiviral Transduction Particles
jagunal homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026365.1-417s1c1
Sequence:CCGGCCTCATTTATGGCAGCATGGACTCGAGTCCATGCTGCCATAAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026365.1-159s1c1
Sequence:CCGGGATGAGTGTGACCCTCAAGTACTCGAGTACTTGAGGGTCACACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026365.1-910s1c1
Sequence:CCGGGCCTTATCCTTGCCTTCTCTTCTCGAGAAGAGAAGGCAAGGATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026365.1-177s1c1
Sequence:CCGGGTACGAAATCAAGAAGCTGATCTCGAGATCAGCTTCTTGATTTCGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026365.2-176s21c1
Sequence:CCGGGTACGAAATCAAGAAGCTGATCTCGAGATCAGCTTCTTGATTTCGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026365.2-158s21c1
Sequence:CCGGGATGAGTGTGACCCTCAAGTACTCGAGTACTTGAGGGTCACACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026365.2-909s21c1
Sequence:CCGGGCCTTATCCTTGCCTTCTCTTCTCGAGAAGAGAAGGCAAGGATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026365.2-291s21c1
Sequence:CCGGCAGTGGGAATATCCGTATTTGCTCGAGCAAATACGGATATTCCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks