EMAIL THIS PAGE TO A FRIEND

JAKMIP1

janus kinase and microtubule interacting protein 1

Synonyms: Gababrbp JAMIP1 MARLIN1
Gene ID:
Mouse(76071) janus kinase and microtubule interacting protein 1
Rat(305434) janus kinase and microtubule interacting protein 1
sheep(101113239) janus kinase and microtubule interacting protein 1
domestic guinea pig(100725622) janus kinase and microtubule interacting protein 1
naked mole-rat(101709951) janus kinase and microtubule interacting protein 1
chicken(422854) janus kinase and microtubule interacting protein 1
dog(488830) janus kinase and microtubule interacting protein 1
domestic cat(101092266) janus kinase and microtubule interacting protein 1
Horse(100070079) janus kinase and microtubule interacting protein 1
cow(540970) janus kinase and microtubule interacting protein 1
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144720 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178394 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178394 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178394 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041861 MISSION® esiRNA esiRNA human JAKMIP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099433 Rosetta Predictions human pricing
NM_144720 Rosetta Predictions human pricing
NM_001033894 Rosetta Predictions rat pricing
NM_178394 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320709 predicted 511
2 SASI_Hs02_00320710 predicted 826
3 SASI_Hs02_00320711 predicted 1335
4 SASI_Hs02_00320712 predicted 1781
5 SASI_Hs02_00320713 predicted 1453
6 SASI_Hs02_00320714 predicted 1931
7 SASI_Hs02_00320715 predicted 1612
8 SASI_Hs02_00320716 predicted 1779
9 SASI_Hs02_00320717 predicted 1593
10 SASI_Hs02_00320718 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144720 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364661 predicted 505
2 SASI_Hs02_00364662 predicted 829
3 SASI_Hs01_00226430 predicted 1337
4 SASI_Hs01_00226431 predicted 1787
5 SASI_Hs02_00364663 predicted 1453
6 SASI_Hs02_00364664 predicted 1931
7 SASI_Hs02_00364665 predicted 1613
8 SASI_Hs01_00226434 predicted 1783
9 SASI_Hs02_00364666 predicted 1587
10 SASI_Hs01_00226436 predicted 988
11 SASI_Hs01_00226432 predicted 1372
12 SASI_Hs01_00226433 predicted 1100
13 SASI_Hs01_00226435 predicted 1384
14 SASI_Hs01_00226437 predicted 1795
15 SASI_Hs01_00226438 predicted 1800
16 SASI_Hs01_00226439 predicted 1495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033894 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086576 predicted 2075
2 SASI_Rn01_00086577 predicted 1504
3 SASI_Rn01_00086578 predicted 1996
4 SASI_Rn01_00086579 predicted 2051
5 SASI_Rn01_00086580 predicted 248
6 SASI_Rn01_00086581 predicted 1615
7 SASI_Rn01_00086582 predicted 1702
8 SASI_Rn01_00086583 predicted 1021
9 SASI_Rn01_00086584 predicted 1979
10 SASI_Rn02_00203793 predicted 781
11 SASI_Rn01_00086575 predicted 2071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178394 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129866 predicted 1338
2 SASI_Mm01_00129868 predicted 1006
3 SASI_Mm02_00348802 predicted 681
4 SASI_Mm01_00129869 predicted 243
5 SASI_Mm01_00129870 predicted 661
6 SASI_Mm01_00129871 predicted 1043
7 SASI_Mm01_00129872 predicted 1491
8 SASI_Mm01_00129873 predicted 1610
9 SASI_Mm01_00129874 predicted 1691
10 SASI_Mm02_00348803 predicted 1022
11 SASI_Mm01_00129867 predicted 809
12 SASI_Mm01_00129875 predicted 1309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144720
JAKMIP1 MISSION shRNA Bacterial Glycerol Stock
janus kinase and microtubule interacting protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-534s1c1
Sequence:CCGGCAAGCTGACCAGCATTCAGATCTCGAGATCTGAATGCTGGTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1086s1c1
Sequence:CCGGCAAAGGGAAAGACCGTGTGATCTCGAGATCACACGGTCTTTCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1752s1c1
Sequence:CCGGGAAGCATGTTGTGGAGACATTCTCGAGAATGTCTCCACAACATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1461s1c1
Sequence:CCGGGCGGATGAACAAGAAGAATGACTCGAGTCATTCTTCTTGTTCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2215s1c1
Sequence:CCGGGATCAGAACGAGCTGTTAGAACTCGAGTTCTAACAGCTCGTTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2240s1c1
Sequence:CCGGGAGTGCTAGAACTCGAAGTAACTCGAGTTACTTCGAGTTCTAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2193s1c1
Sequence:CCGGGAATGAAATGCAAGACGCCAACTCGAGTTGGCGTCTTGCATTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2163s1c1
Sequence:CCGGCAGACTGGAAATGGAAGAGAACTCGAGTTCTCTTCCATTTCCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2118s1c1
Sequence:CCGGGCAGCTGCTCATCAGAACAAACTCGAGTTTGTTCTGATGAGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1303s1c1
Sequence:CCGGCGAGATGTGAGGCGATTTCAACTCGAGTTGAAATCGCCTCACATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1162s1c1
Sequence:CCGGCTGCAGAAAGAGGCTTTGGATCTCGAGATCCAAAGCCTCTTTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144720
JAKMIP1 MISSION shRNA shRNA Plasmid DNA
janus kinase and microtubule interacting protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-534s1c1
Sequence:CCGGCAAGCTGACCAGCATTCAGATCTCGAGATCTGAATGCTGGTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1086s1c1
Sequence:CCGGCAAAGGGAAAGACCGTGTGATCTCGAGATCACACGGTCTTTCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1752s1c1
Sequence:CCGGGAAGCATGTTGTGGAGACATTCTCGAGAATGTCTCCACAACATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1461s1c1
Sequence:CCGGGCGGATGAACAAGAAGAATGACTCGAGTCATTCTTCTTGTTCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2215s1c1
Sequence:CCGGGATCAGAACGAGCTGTTAGAACTCGAGTTCTAACAGCTCGTTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2240s1c1
Sequence:CCGGGAGTGCTAGAACTCGAAGTAACTCGAGTTACTTCGAGTTCTAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2193s1c1
Sequence:CCGGGAATGAAATGCAAGACGCCAACTCGAGTTGGCGTCTTGCATTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2163s1c1
Sequence:CCGGCAGACTGGAAATGGAAGAGAACTCGAGTTCTCTTCCATTTCCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2118s1c1
Sequence:CCGGGCAGCTGCTCATCAGAACAAACTCGAGTTTGTTCTGATGAGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1303s1c1
Sequence:CCGGCGAGATGTGAGGCGATTTCAACTCGAGTTGAAATCGCCTCACATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1162s1c1
Sequence:CCGGCTGCAGAAAGAGGCTTTGGATCTCGAGATCCAAAGCCTCTTTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144720
JAKMIP1 MISSION shRNA Lentiviral Transduction Particles
janus kinase and microtubule interacting protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164506    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-534s1c1
Sequence:CCGGCAAGCTGACCAGCATTCAGATCTCGAGATCTGAATGCTGGTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1086s1c1
Sequence:CCGGCAAAGGGAAAGACCGTGTGATCTCGAGATCACACGGTCTTTCCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1752s1c1
Sequence:CCGGGAAGCATGTTGTGGAGACATTCTCGAGAATGTCTCCACAACATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160858    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1461s1c1
Sequence:CCGGGCGGATGAACAAGAAGAATGACTCGAGTCATTCTTCTTGTTCATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2215s1c1
Sequence:CCGGGATCAGAACGAGCTGTTAGAACTCGAGTTCTAACAGCTCGTTCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2240s1c1
Sequence:CCGGGAGTGCTAGAACTCGAAGTAACTCGAGTTACTTCGAGTTCTAGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162026    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2193s1c1
Sequence:CCGGGAATGAAATGCAAGACGCCAACTCGAGTTGGCGTCTTGCATTTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162228    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2163s1c1
Sequence:CCGGCAGACTGGAAATGGAAGAGAACTCGAGTTCTCTTCCATTTCCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-2118s1c1
Sequence:CCGGGCAGCTGCTCATCAGAACAAACTCGAGTTTGTTCTGATGAGCAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1303s1c1
Sequence:CCGGCGAGATGTGAGGCGATTTCAACTCGAGTTGAAATCGCCTCACATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164442    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144720.1-1162s1c1
Sequence:CCGGCTGCAGAAAGAGGCTTTGGATCTCGAGATCCAAAGCCTCTTTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178394
JAKMIP1 MISSION shRNA Bacterial Glycerol Stock
janus kinase and microtubule interacting protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178394.3-1019s21c1
Sequence:CCGGGGGTGGCCAGGATCAACATATCTCGAGATATGTTGATCCTGGCCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178394.3-1044s21c1
Sequence:CCGGGAGCGAGATGTGAGGCGATTTCTCGAGAAATCGCCTCACATCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178394.3-1985s21c1
Sequence:CCGGAGTGCTAGAACTCGAAGTAAGCTCGAGCTTACTTCGAGTTCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178394.3-2097s21c1
Sequence:CCGGATGTGTGAAGGGACGTGTTACCTCGAGGTAACACGTCCCTTCACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178394.3-1925s21c1
Sequence:CCGGGAACCAGCTAAAGAGCGAAATCTCGAGATTTCGCTCTTTAGCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178394
JAKMIP1 MISSION shRNA shRNA Plasmid DNA
janus kinase and microtubule interacting protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178394.3-1019s21c1
Sequence:CCGGGGGTGGCCAGGATCAACATATCTCGAGATATGTTGATCCTGGCCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178394.3-1044s21c1
Sequence:CCGGGAGCGAGATGTGAGGCGATTTCTCGAGAAATCGCCTCACATCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178394.3-1985s21c1
Sequence:CCGGAGTGCTAGAACTCGAAGTAAGCTCGAGCTTACTTCGAGTTCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178394.3-2097s21c1
Sequence:CCGGATGTGTGAAGGGACGTGTTACCTCGAGGTAACACGTCCCTTCACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178394.3-1925s21c1
Sequence:CCGGGAACCAGCTAAAGAGCGAAATCTCGAGATTTCGCTCTTTAGCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178394
JAKMIP1 MISSION shRNA Lentiviral Transduction Particles
janus kinase and microtubule interacting protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178394.3-1019s21c1
Sequence:CCGGGGGTGGCCAGGATCAACATATCTCGAGATATGTTGATCCTGGCCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178394.3-1044s21c1
Sequence:CCGGGAGCGAGATGTGAGGCGATTTCTCGAGAAATCGCCTCACATCTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178394.3-1985s21c1
Sequence:CCGGAGTGCTAGAACTCGAAGTAAGCTCGAGCTTACTTCGAGTTCTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247946    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178394.3-2097s21c1
Sequence:CCGGATGTGTGAAGGGACGTGTTACCTCGAGGTAACACGTCCCTTCACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178394.3-1925s21c1
Sequence:CCGGGAACCAGCTAAAGAGCGAAATCTCGAGATTTCGCTCTTTAGCTGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks