EMAIL THIS PAGE TO A FRIEND

JMJD7-PLA2G4B

JMJD7-PLA2G4B readthrough

Synonyms: HsT16992 cPLA2-beta
Species: Human JMJD7-PLA2G4B(8681)
Gene ID:
Human(8681) Summary: This gene transcribes naturally-occurring mRNAs that are read-through products of the neighboring jumonji domain containing 7 (JMJD7) and phospholipase A2, group IVB (PLA2G4B) genes. These read-through products contain in-frame segments from both genes but a function has yet to be determined for the predicted fusion proteins, which contain a partial JmjC domain and downstream C2 and phospholipase A2 domains. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Sep 2011]
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005090 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005090 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005090 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087201 MISSION® esiRNA esiRNA human PLA2G4B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005090 Rosetta Predictions human pricing
NR_015346 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338950 predicted 2369
2 SASI_Hs02_00338951 predicted 2247
3 SASI_Hs02_00338952 predicted 1698
4 SASI_Hs02_00338953 predicted 940
5 SASI_Hs02_00338954 predicted 2157
6 SASI_Hs01_00072135 predicted 1369
7 SASI_Hs01_00072138 predicted 2370
8 SASI_Hs02_00338955 predicted 1393
9 SASI_Hs02_00338956 predicted 1212
10 SASI_Hs02_00338957 predicted 2486
11 SASI_Hs01_00072133 predicted 944
12 SASI_Hs01_00072134 predicted 2484
13 SASI_Hs01_00072136 predicted 512
14 SASI_Hs01_00072137 predicted 2027
15 SASI_Hs01_00072139 predicted 2257
16 SASI_Hs01_00072140 predicted 693
17 SASI_Hs01_00072141 predicted 1754
18 SASI_Hs01_00072142 predicted 1402
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_015346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381102 predicted 841
2 SASI_Hs02_00381103 predicted 840
3 SASI_Hs02_00381104 predicted 3397
4 SASI_Hs02_00381105 predicted 4840
5 SASI_Hs02_00381106 predicted 1147
6 SASI_Hs02_00381107 predicted 509
7 SASI_Hs02_00381108 predicted 2755
8 SASI_Hs02_00381109 predicted 2181
9 SASI_Hs02_00381110 predicted 6225
10 SASI_Hs02_00381111 predicted 6116
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005090
VALIDATED
JMJD7-PLA2G4B MISSION shRNA Bacterial Glycerol Stock
JMJD7-PLA2G4B readthrough
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005090.3-2432s21c1
Sequence:GTACCGGGCCCAGGCCACACATAATTTCCTCGAGGAAATTATGTGTGGCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005090.3-1612s21c1
Sequence:CCGGGATCCCAGTGGTAGCTATTATCTCGAGATAATAGCTACCACTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005090.3-2254s21c1
Sequence:CCGGCAACCTCCAGGACAGCTTATACTCGAGTATAAGCTGTCCTGGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005090.3-2466s21c1
Sequence:CCGGATTTCCACAAAGACTACTTTCCTCGAGGAAAGTAGTCTTTGTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005090.3-692s21c1
Sequence:CCGGCTAACTGAAGAGGGCACCTTTCTCGAGAAAGGTGCCCTCTTCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005090.3-3130s21c1
Sequence:CCGGGTTGCAGGTGGGAACTGTCATCTCGAGATGACAGTTCCCACCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005090.3-567s21c1
Sequence:GTACCGGCTTTGCACAAGGACCACTATGCTCGAGCATAGTGGTCCTTGTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005090.1-3075s1c1
Sequence:CCGGCCTAACTCTCATTCATTCCCTCTCGAGAGGGAATGAATGAGAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005090.1-667s1c1
Sequence:CCGGCTAACTGAAGAGGGCACCTTTCTCGAGAAAGGTGCCCTCTTCAGTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005090.1-2467s1c1
Sequence:CCGGCCTCACTTCTCCACATGGAAACTCGAGTTTCCATGTGGAGAAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005090.1-919s1c1
Sequence:CCGGCAGCTCAAGAATGTCATGGAACTCGAGTTCCATGACATTCTTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005090.1-2613s1c1
Sequence:CCGGCCTCATCCTGTCATTGGACTACTCGAGTAGTCCAATGACAGGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005090
VALIDATED
JMJD7-PLA2G4B MISSION shRNA shRNA Plasmid DNA
JMJD7-PLA2G4B readthrough
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005090.3-2432s21c1
Sequence:GTACCGGGCCCAGGCCACACATAATTTCCTCGAGGAAATTATGTGTGGCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005090.3-1612s21c1
Sequence:CCGGGATCCCAGTGGTAGCTATTATCTCGAGATAATAGCTACCACTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005090.3-2254s21c1
Sequence:CCGGCAACCTCCAGGACAGCTTATACTCGAGTATAAGCTGTCCTGGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005090.3-2466s21c1
Sequence:CCGGATTTCCACAAAGACTACTTTCCTCGAGGAAAGTAGTCTTTGTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005090.3-692s21c1
Sequence:CCGGCTAACTGAAGAGGGCACCTTTCTCGAGAAAGGTGCCCTCTTCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005090.3-3130s21c1
Sequence:CCGGGTTGCAGGTGGGAACTGTCATCTCGAGATGACAGTTCCCACCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005090.3-567s21c1
Sequence:GTACCGGCTTTGCACAAGGACCACTATGCTCGAGCATAGTGGTCCTTGTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005090.1-3075s1c1
Sequence:CCGGCCTAACTCTCATTCATTCCCTCTCGAGAGGGAATGAATGAGAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005090.1-667s1c1
Sequence:CCGGCTAACTGAAGAGGGCACCTTTCTCGAGAAAGGTGCCCTCTTCAGTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005090.1-2467s1c1
Sequence:CCGGCCTCACTTCTCCACATGGAAACTCGAGTTTCCATGTGGAGAAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005090.1-919s1c1
Sequence:CCGGCAGCTCAAGAATGTCATGGAACTCGAGTTCCATGACATTCTTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005090.1-2613s1c1
Sequence:CCGGCCTCATCCTGTCATTGGACTACTCGAGTAGTCCAATGACAGGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005090
VALIDATED
JMJD7-PLA2G4B MISSION shRNA Lentiviral Transduction Particles
JMJD7-PLA2G4B readthrough
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005090.3-2432s21c1
Sequence:GTACCGGGCCCAGGCCACACATAATTTCCTCGAGGAAATTATGTGTGGCCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005090.3-1612s21c1
Sequence:CCGGGATCCCAGTGGTAGCTATTATCTCGAGATAATAGCTACCACTGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005090.3-2254s21c1
Sequence:CCGGCAACCTCCAGGACAGCTTATACTCGAGTATAAGCTGTCCTGGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005090.3-2466s21c1
Sequence:CCGGATTTCCACAAAGACTACTTTCCTCGAGGAAAGTAGTCTTTGTGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_005090.3-692s21c1
Sequence:CCGGCTAACTGAAGAGGGCACCTTTCTCGAGAAAGGTGCCCTCTTCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005090.3-3130s21c1
Sequence:CCGGGTTGCAGGTGGGAACTGTCATCTCGAGATGACAGTTCCCACCTGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005090.3-567s21c1
Sequence:GTACCGGCTTTGCACAAGGACCACTATGCTCGAGCATAGTGGTCCTTGTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005090.1-3075s1c1
Sequence:CCGGCCTAACTCTCATTCATTCCCTCTCGAGAGGGAATGAATGAGAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005090.1-667s1c1
Sequence:CCGGCTAACTGAAGAGGGCACCTTTCTCGAGAAAGGTGCCCTCTTCAGTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005090.1-2467s1c1
Sequence:CCGGCCTCACTTCTCCACATGGAAACTCGAGTTTCCATGTGGAGAAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005090.1-919s1c1
Sequence:CCGGCAGCTCAAGAATGTCATGGAACTCGAGTTCCATGACATTCTTGAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005090.1-2613s1c1
Sequence:CCGGCCTCATCCTGTCATTGGACTACTCGAGTAGTCCAATGACAGGATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks