EMAIL THIS PAGE TO A FRIEND

JPH1

junctophilin 1

Synonyms: JP-1 JP1
UniProtKB ID: Q9HDC5, B2RTZ0
Gene ID:
Human(56704) Summary: Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. [provided by RefSeq, Jul 2008]
Mouse(57339) junctophilin 1
Rat(297748) junctophilin 1
chicken(420190) junctophilin 1
domestic cat(101082124) junctophilin 1
cow(536811) junctophilin 1
dog(487001) junctophilin 1
naked mole-rat(101721322) junctophilin 1
sheep(101117255) junctophilin 1
193 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020647 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020647 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020647 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078801 MISSION® esiRNA esiRNA human JPH1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020647 Rosetta Predictions human pricing
NM_001106630 Rosetta Predictions rat pricing
NM_020604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020647 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232835 predicted 981
2 SASI_Hs01_00232836 predicted 1872
3 SASI_Hs01_00232837 predicted 1688
4 SASI_Hs01_00232838 predicted 2050
5 SASI_Hs01_00232839 predicted 1155
6 SASI_Hs01_00232840 predicted 933
7 SASI_Hs01_00232841 predicted 2035
8 SASI_Hs01_00232842 predicted 1300
9 SASI_Hs01_00232844 predicted 1944
10 SASI_Hs02_00353625 predicted 1943
11 SASI_Hs01_00232843 predicted 1866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220838 predicted 1828
2 SASI_Rn02_00220839 predicted 867
3 SASI_Rn02_00220840 predicted 2080
4 SASI_Rn02_00220841 predicted 1833
5 SASI_Rn02_00220842 predicted 2091
6 SASI_Rn02_00220843 predicted 1713
7 SASI_Rn02_00220844 predicted 1450
8 SASI_Rn02_00220845 predicted 376
9 SASI_Rn02_00220846 predicted 803
10 SASI_Rn02_00220847 predicted 2019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020713 predicted 1707
2 SASI_Mm01_00020715 predicted 1923
3 SASI_Mm01_00020717 predicted 1266
4 SASI_Mm01_00020718 predicted 1718
5 SASI_Mm01_00020719 predicted 1827
6 SASI_Mm02_00325709 predicted 964
7 SASI_Mm01_00020720 predicted 716
8 SASI_Mm02_00325710 predicted 775
9 SASI_Mm01_00020721 predicted 931
10 SASI_Mm01_00020722 predicted 1455
11 SASI_Mm01_00020714 predicted 1724
12 SASI_Mm01_00020716 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020647
VALIDATED
JPH1 MISSION shRNA Bacterial Glycerol Stock
junctophilin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020647.2-1906s1c1
Sequence:CCGGCAACGATTCATGCCCTGCTTTCTCGAGAAAGCAGGGCATGAATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020647.2-1169s1c1
Sequence:CCGGGCAAATTCAAGGACTGCACATCTCGAGATGTGCAGTCCTTGAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020647.2-1152s1c1
Sequence:CCGGGAACCAAAGTGGAAATAGCAACTCGAGTTGCTATTTCCACTTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020647.2-3111s1c1
Sequence:CCGGCCCATGAAAGTTAAGCAAGATCTCGAGATCTTGCTTAACTTTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020647.2-1678s1c1
Sequence:CCGGGCATTCTCAGTATCACGGCTACTCGAGTAGCCGTGATACTGAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020647.2-1514s1c1
Sequence:CCGGGCGAGACTCAACCAAGACAAACTCGAGTTTGTCTTGGTTGAGTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020647.2-1936s21c1
Sequence:CCGGAGCCAATTCAGGCCCTAATTCCTCGAGGAATTAGGGCCTGAATTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020647.2-1041s21c1
Sequence:CCGGATATTCTGGTCCGTGGGATAACTCGAGTTATCCCACGGACCAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020647
VALIDATED
JPH1 MISSION shRNA shRNA Plasmid DNA
junctophilin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020647.2-1906s1c1
Sequence:CCGGCAACGATTCATGCCCTGCTTTCTCGAGAAAGCAGGGCATGAATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020647.2-1169s1c1
Sequence:CCGGGCAAATTCAAGGACTGCACATCTCGAGATGTGCAGTCCTTGAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020647.2-1152s1c1
Sequence:CCGGGAACCAAAGTGGAAATAGCAACTCGAGTTGCTATTTCCACTTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020647.2-3111s1c1
Sequence:CCGGCCCATGAAAGTTAAGCAAGATCTCGAGATCTTGCTTAACTTTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020647.2-1678s1c1
Sequence:CCGGGCATTCTCAGTATCACGGCTACTCGAGTAGCCGTGATACTGAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020647.2-1514s1c1
Sequence:CCGGGCGAGACTCAACCAAGACAAACTCGAGTTTGTCTTGGTTGAGTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020647.2-1936s21c1
Sequence:CCGGAGCCAATTCAGGCCCTAATTCCTCGAGGAATTAGGGCCTGAATTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020647.2-1041s21c1
Sequence:CCGGATATTCTGGTCCGTGGGATAACTCGAGTTATCCCACGGACCAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020647
VALIDATED
JPH1 MISSION shRNA Lentiviral Transduction Particles
junctophilin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020647.2-1906s1c1
Sequence:CCGGCAACGATTCATGCCCTGCTTTCTCGAGAAAGCAGGGCATGAATCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020647.2-1169s1c1
Sequence:CCGGGCAAATTCAAGGACTGCACATCTCGAGATGTGCAGTCCTTGAATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020647.2-1152s1c1
Sequence:CCGGGAACCAAAGTGGAAATAGCAACTCGAGTTGCTATTTCCACTTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020647.2-3111s1c1
Sequence:CCGGCCCATGAAAGTTAAGCAAGATCTCGAGATCTTGCTTAACTTTCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020647.2-1678s1c1
Sequence:CCGGGCATTCTCAGTATCACGGCTACTCGAGTAGCCGTGATACTGAGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020647.2-1514s1c1
Sequence:CCGGGCGAGACTCAACCAAGACAAACTCGAGTTTGTCTTGGTTGAGTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020647.2-1936s21c1
Sequence:CCGGAGCCAATTCAGGCCCTAATTCCTCGAGGAATTAGGGCCTGAATTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020647.2-1041s21c1
Sequence:CCGGATATTCTGGTCCGTGGGATAACTCGAGTTATCCCACGGACCAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020604
JPH1 MISSION shRNA Bacterial Glycerol Stock
junctophilin 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020604.1-1537s1c1
Sequence:CCGGCACCAAAGGAATCTCCTCATTCTCGAGAATGAGGAGATTCCTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020604.1-1704s1c1
Sequence:CCGGGAGGAACAAGTGACAGCCTTTCTCGAGAAAGGCTGTCACTTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020604.1-1844s1c1
Sequence:CCGGCGGCTACTATGTGAAACTGAACTCGAGTTCAGTTTCACATAGTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020604.1-1720s1c1
Sequence:CCGGCCTTTGTCAATAAACCCTCTACTCGAGTAGAGGGTTTATTGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020604
JPH1 MISSION shRNA shRNA Plasmid DNA
junctophilin 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020604.1-1537s1c1
Sequence:CCGGCACCAAAGGAATCTCCTCATTCTCGAGAATGAGGAGATTCCTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020604.1-1704s1c1
Sequence:CCGGGAGGAACAAGTGACAGCCTTTCTCGAGAAAGGCTGTCACTTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020604.1-1844s1c1
Sequence:CCGGCGGCTACTATGTGAAACTGAACTCGAGTTCAGTTTCACATAGTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020604.1-1720s1c1
Sequence:CCGGCCTTTGTCAATAAACCCTCTACTCGAGTAGAGGGTTTATTGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020604
JPH1 MISSION shRNA Lentiviral Transduction Particles
junctophilin 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020604.1-1537s1c1
Sequence:CCGGCACCAAAGGAATCTCCTCATTCTCGAGAATGAGGAGATTCCTTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020604.1-1704s1c1
Sequence:CCGGGAGGAACAAGTGACAGCCTTTCTCGAGAAAGGCTGTCACTTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020604.1-1844s1c1
Sequence:CCGGCGGCTACTATGTGAAACTGAACTCGAGTTCAGTTTCACATAGTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020604.1-1720s1c1
Sequence:CCGGCCTTTGTCAATAAACCCTCTACTCGAGTAGAGGGTTTATTGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks