EMAIL THIS PAGE TO A FRIEND

JRK

jerky homolog (mouse)

Synonyms: JH8
UniProtKB ID: O75564, O75565
Gene ID:
Human(8629) Summary: This gene encodes a conserved protein that is similar to DNA-binding proteins, such as major centromere autoantigen B (CENPB). Inactivation of the related gene in mice resulted in epileptic seizures. Childhood Absence Epilepsy (CAE) has been mapped to the same chromosomal location (8q24.3) as this gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(16469) jerky
Rat(315073) jerky homolog (mouse)
dog(482067) jerky homolog (mouse)
domestic cat(101086701) jerky homolog (mouse)
cow(517625) jerky homolog (mouse)
Horse(100066602) jerky homolog (mouse)
sheep(101117087) jerky homolog (mouse)
domestic guinea pig(100723748) jerky homolog (mouse)
naked mole-rat(101704494) jerky homolog (mouse)
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003724 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003724 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003724 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077527 Rosetta Predictions human pricing
NM_003724 Rosetta Predictions human pricing
NM_001104612 Rosetta Predictions rat pricing
NM_008415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312964 predicted 1507
2 SASI_Hs02_00312965 predicted 878
3 SASI_Hs02_00312966 predicted 953
4 SASI_Hs02_00312967 predicted 1346
5 SASI_Hs02_00312968 predicted 1311
6 SASI_Hs02_00312969 predicted 650
7 SASI_Hs02_00312970 predicted 1191
8 SASI_Hs02_00312971 predicted 1720
9 SASI_Hs02_00312972 predicted 852
10 SASI_Hs02_00312973 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336161 predicted 1504
2 SASI_Hs01_00201958 predicted 880
3 SASI_Hs01_00201960 predicted 947
4 SASI_Hs01_00201961 predicted 1344
5 SASI_Hs02_00336162 predicted 1314
6 SASI_Hs01_00201964 predicted 650
7 SASI_Hs01_00201966 predicted 1192
8 SASI_Hs02_00336163 predicted 1713
9 SASI_Hs02_00336164 predicted 857
10 SASI_Hs02_00336165 predicted 1667
11 SASI_Hs01_00201957 predicted 1456
12 SASI_Hs01_00201959 predicted 1464
13 SASI_Hs01_00201962 predicted 2327
14 SASI_Hs01_00201963 predicted 2596
15 SASI_Hs01_00201965 predicted 2483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211666 predicted 1911
2 SASI_Rn02_00211667 predicted 1482
3 SASI_Rn02_00211668 predicted 1640
4 SASI_Rn02_00211669 predicted 1022
5 SASI_Rn02_00211670 predicted 1476
6 SASI_Rn02_00211671 predicted 1931
7 SASI_Rn02_00211672 predicted 1001
8 SASI_Rn02_00211673 predicted 1104
9 SASI_Rn02_00211674 predicted 1568
10 SASI_Rn02_00211675 predicted 1826
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313863 predicted 1475
2 SASI_Mm01_00056176 predicted 1576
3 SASI_Mm02_00313864 predicted 1152
4 SASI_Mm01_00056177 predicted 1977
5 SASI_Mm01_00056179 predicted 1377
6 SASI_Mm01_00056180 predicted 1255
7 SASI_Mm01_00056181 predicted 1891
8 SASI_Mm01_00056182 predicted 1367
9 SASI_Mm01_00056183 predicted 622
10 SASI_Mm01_00056184 predicted 778
11 SASI_Mm01_00056178 predicted 1255
12 SASI_Mm01_00056185 predicted 2067
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008415
VALIDATED
JRK MISSION shRNA Bacterial Glycerol Stock
jerky homolog (mouse)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008415.3-3102s1c1
Sequence:CCGGGCTTTGTTCTTGACCTTCATTCTCGAGAATGAAGGTCAAGAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008415.3-613s1c1
Sequence:CCGGAGTATAATGTGGGCATGTTTACTCGAGTAAACATGCCCACATTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008415.3-1226s1c1
Sequence:CCGGGCACCTGCCTATTGCTTACAACTCGAGTTGTAAGCAATAGGCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008415.3-600s1c1
Sequence:CCGGGCTCTGATGCAGGAGTATAATCTCGAGATTATACTCCTGCATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008415.5-1309s21c1
Sequence:CCGGCAGACTGGTTCCATCATATTTCTCGAGAAATATGATGGAACCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008415.5-1156s21c1
Sequence:CCGGCTGTCTTGATGTGCGCTAATGCTCGAGCATTAGCGCACATCAAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008415.5-2393s21c1
Sequence:CCGGAGCACAGATAATCTATCATTTCTCGAGAAATGATAGATTATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008415.5-1520s21c1
Sequence:CCGGCTTCATGAGGCTCTTTATTAACTCGAGTTAATAAAGAGCCTCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008415.5-1745s21c1
Sequence:CCGGACACATCCTTGGGCTTGTAAACTCGAGTTTACAAGCCCAAGGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008415
VALIDATED
JRK MISSION shRNA shRNA Plasmid DNA
jerky homolog (mouse)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008415.3-3102s1c1
Sequence:CCGGGCTTTGTTCTTGACCTTCATTCTCGAGAATGAAGGTCAAGAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008415.3-613s1c1
Sequence:CCGGAGTATAATGTGGGCATGTTTACTCGAGTAAACATGCCCACATTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008415.3-1226s1c1
Sequence:CCGGGCACCTGCCTATTGCTTACAACTCGAGTTGTAAGCAATAGGCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008415.3-600s1c1
Sequence:CCGGGCTCTGATGCAGGAGTATAATCTCGAGATTATACTCCTGCATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008415.5-1309s21c1
Sequence:CCGGCAGACTGGTTCCATCATATTTCTCGAGAAATATGATGGAACCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008415.5-1156s21c1
Sequence:CCGGCTGTCTTGATGTGCGCTAATGCTCGAGCATTAGCGCACATCAAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008415.5-2393s21c1
Sequence:CCGGAGCACAGATAATCTATCATTTCTCGAGAAATGATAGATTATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008415.5-1520s21c1
Sequence:CCGGCTTCATGAGGCTCTTTATTAACTCGAGTTAATAAAGAGCCTCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008415.5-1745s21c1
Sequence:CCGGACACATCCTTGGGCTTGTAAACTCGAGTTTACAAGCCCAAGGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008415
VALIDATED
JRK MISSION shRNA Lentiviral Transduction Particles
jerky homolog (mouse)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124914    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008415.3-3102s1c1
Sequence:CCGGGCTTTGTTCTTGACCTTCATTCTCGAGAATGAAGGTCAAGAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008415.3-613s1c1
Sequence:CCGGAGTATAATGTGGGCATGTTTACTCGAGTAAACATGCCCACATTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008415.3-1226s1c1
Sequence:CCGGGCACCTGCCTATTGCTTACAACTCGAGTTGTAAGCAATAGGCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008415.3-600s1c1
Sequence:CCGGGCTCTGATGCAGGAGTATAATCTCGAGATTATACTCCTGCATCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008415.5-1309s21c1
Sequence:CCGGCAGACTGGTTCCATCATATTTCTCGAGAAATATGATGGAACCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008415.5-1156s21c1
Sequence:CCGGCTGTCTTGATGTGCGCTAATGCTCGAGCATTAGCGCACATCAAGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008415.5-2393s21c1
Sequence:CCGGAGCACAGATAATCTATCATTTCTCGAGAAATGATAGATTATCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008415.5-1520s21c1
Sequence:CCGGCTTCATGAGGCTCTTTATTAACTCGAGTTAATAAAGAGCCTCATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008415.5-1745s21c1
Sequence:CCGGACACATCCTTGGGCTTGTAAACTCGAGTTTACAAGCCCAAGGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003724
JRK MISSION shRNA Bacterial Glycerol Stock
jerky homolog (mouse)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003724.1-1521s1c1
Sequence:CCGGCAACATGAACGATGCCATATTCTCGAGAATATGGCATCGTTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003724.1-2997s1c1
Sequence:CCGGGCCTTTACATGAATACGTCTTCTCGAGAAGACGTATTCATGTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003724.1-1680s1c1
Sequence:CCGGCCACAACAAGTCCTTTGCACACTCGAGTGTGCAAAGGACTTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003724.2-1358s21c1
Sequence:CCGGCACTTCAGAACCATAGGTTTGCTCGAGCAAACCTATGGTTCTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003724.2-2391s21c1
Sequence:CCGGTGCCCGAGGTTCCTGTCAATACTCGAGTATTGACAGGAACCTCGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003724.2-1316s1c1
Sequence:CCGGTCCGATTGGTTCCATCATATCCTCGAGGATATGATGGAACCAATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003724.2-913s1c1
Sequence:CCGGAGGGTGGCTTTGGCGCTTTAACTCGAGTTAAAGCGCCAAAGCCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003724
JRK MISSION shRNA shRNA Plasmid DNA
jerky homolog (mouse)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003724.1-1521s1c1
Sequence:CCGGCAACATGAACGATGCCATATTCTCGAGAATATGGCATCGTTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003724.1-2997s1c1
Sequence:CCGGGCCTTTACATGAATACGTCTTCTCGAGAAGACGTATTCATGTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003724.1-1680s1c1
Sequence:CCGGCCACAACAAGTCCTTTGCACACTCGAGTGTGCAAAGGACTTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003724.2-1358s21c1
Sequence:CCGGCACTTCAGAACCATAGGTTTGCTCGAGCAAACCTATGGTTCTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003724.2-2391s21c1
Sequence:CCGGTGCCCGAGGTTCCTGTCAATACTCGAGTATTGACAGGAACCTCGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003724.2-1316s1c1
Sequence:CCGGTCCGATTGGTTCCATCATATCCTCGAGGATATGATGGAACCAATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003724.2-913s1c1
Sequence:CCGGAGGGTGGCTTTGGCGCTTTAACTCGAGTTAAAGCGCCAAAGCCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003724
JRK MISSION shRNA Lentiviral Transduction Particles
jerky homolog (mouse)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148274    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003724.1-1521s1c1
Sequence:CCGGCAACATGAACGATGCCATATTCTCGAGAATATGGCATCGTTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003724.1-2997s1c1
Sequence:CCGGGCCTTTACATGAATACGTCTTCTCGAGAAGACGTATTCATGTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180241    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003724.1-1680s1c1
Sequence:CCGGCCACAACAAGTCCTTTGCACACTCGAGTGTGCAAAGGACTTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003724.2-1358s21c1
Sequence:CCGGCACTTCAGAACCATAGGTTTGCTCGAGCAAACCTATGGTTCTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003724.2-2391s21c1
Sequence:CCGGTGCCCGAGGTTCCTGTCAATACTCGAGTATTGACAGGAACCTCGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219822    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003724.2-1316s1c1
Sequence:CCGGTCCGATTGGTTCCATCATATCCTCGAGGATATGATGGAACCAATCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003724.2-913s1c1
Sequence:CCGGAGGGTGGCTTTGGCGCTTTAACTCGAGTTAAAGCGCCAAAGCCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks