EMAIL THIS PAGE TO A FRIEND

KAL1

Kallmann syndrome 1 sequence

Synonyms: ADMLX HH1 HHA KAL KALIG-1 KMS WFDC19
UniProtKB ID: P23352, B2RPF8
Gene ID:
Human(3730) Summary: Mutations in this gene cause the X-linked Kallmann syndrome. The encoded protein is similar in sequence to proteins known to function in neural cell adhesion and axonal migration. In addition, this cell surface protein is N-glycosylated and may have anti-protease activity. [provided by RefSeq, Jul 2008]
fruit fly(42865) Kallmann syndrome 1 ortholog
domestic cat(101084002) Kallmann syndrome 1 sequence
cow(101910119) Kallmann syndrome 1 sequence
Horse(100053718) Kallmann syndrome 1 sequence
dog(610921) Kallmann syndrome 1 sequence
chicken(396395) Kallmann syndrome 1 sequence
domestic guinea pig(100712973) Kallmann syndrome 1 sequence
naked mole-rat(101720284) Kallmann syndrome 1 sequence
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000216 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000216 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000216 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111281 MISSION® esiRNA esiRNA human KAL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000216 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015707 predicted 626
2 SASI_Hs01_00015708 predicted 885
3 SASI_Hs01_00015710 predicted 746
4 SASI_Hs01_00015711 predicted 2129
5 SASI_Hs01_00015712 predicted 2219
6 SASI_Hs01_00015713 predicted 1997
7 SASI_Hs01_00015714 predicted 2015
8 SASI_Hs02_00302104 predicted 657
9 SASI_Hs02_00302105 predicted 1450
10 SASI_Hs01_00015715 predicted 1513
11 SASI_Hs01_00015709 predicted 760
12 SASI_Hs01_00015716 predicted 1990
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000216
KAL1 MISSION shRNA Bacterial Glycerol Stock
Kallmann syndrome 1 sequence
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000216.2-2565s21c1
Sequence:CCGGCACATAACACTAAGCGTAAATCTCGAGATTTACGCTTAGTGTTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000216.2-752s21c1
Sequence:CCGGAGGTTAAGTGGTCCTCGAAATCTCGAGATTTCGAGGACCACTTAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000216.1-4585s1c1
Sequence:CCGGGCAGCTCTTATGGGCTTCTAACTCGAGTTAGAAGCCCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000216.1-889s1c1
Sequence:CCGGCGAGTTCAACTGACTGACATACTCGAGTATGTCAGTCAGTTGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000216.1-1816s1c1
Sequence:CCGGGCTTCATTCATCGTCCAGGATCTCGAGATCCTGGACGATGAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000216.1-791s1c1
Sequence:CCGGCTGTGATCTATGTGGTACAAACTCGAGTTTGTACCACATAGATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000216.1-1988s1c1
Sequence:CCGGCTTCCGATCATTATGTCCTAACTCGAGTTAGGACATAATGATCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000216
KAL1 MISSION shRNA shRNA Plasmid DNA
Kallmann syndrome 1 sequence
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000216.2-2565s21c1
Sequence:CCGGCACATAACACTAAGCGTAAATCTCGAGATTTACGCTTAGTGTTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000216.2-752s21c1
Sequence:CCGGAGGTTAAGTGGTCCTCGAAATCTCGAGATTTCGAGGACCACTTAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000216.1-4585s1c1
Sequence:CCGGGCAGCTCTTATGGGCTTCTAACTCGAGTTAGAAGCCCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000216.1-889s1c1
Sequence:CCGGCGAGTTCAACTGACTGACATACTCGAGTATGTCAGTCAGTTGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000216.1-1816s1c1
Sequence:CCGGGCTTCATTCATCGTCCAGGATCTCGAGATCCTGGACGATGAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000216.1-791s1c1
Sequence:CCGGCTGTGATCTATGTGGTACAAACTCGAGTTTGTACCACATAGATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000216.1-1988s1c1
Sequence:CCGGCTTCCGATCATTATGTCCTAACTCGAGTTAGGACATAATGATCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000216
KAL1 MISSION shRNA Lentiviral Transduction Particles
Kallmann syndrome 1 sequence
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000216.2-2565s21c1
Sequence:CCGGCACATAACACTAAGCGTAAATCTCGAGATTTACGCTTAGTGTTATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000216.2-752s21c1
Sequence:CCGGAGGTTAAGTGGTCCTCGAAATCTCGAGATTTCGAGGACCACTTAACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000216.1-4585s1c1
Sequence:CCGGGCAGCTCTTATGGGCTTCTAACTCGAGTTAGAAGCCCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000216.1-889s1c1
Sequence:CCGGCGAGTTCAACTGACTGACATACTCGAGTATGTCAGTCAGTTGAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000216.1-1816s1c1
Sequence:CCGGGCTTCATTCATCGTCCAGGATCTCGAGATCCTGGACGATGAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000216.1-791s1c1
Sequence:CCGGCTGTGATCTATGTGGTACAAACTCGAGTTTGTACCACATAGATCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000216.1-1988s1c1
Sequence:CCGGCTTCCGATCATTATGTCCTAACTCGAGTTAGGACATAATGATCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks