EMAIL THIS PAGE TO A FRIEND

KANK3

KN motif and ankyrin repeat domains 3

Synonyms: ANKRD47
UniProtKB ID: Q6NY19, Q6NZI1, Q6ZQR3, Q8IUV2
Gene ID:
Mouse(80880) KN motif and ankyrin repeat domains 3
Rat(366848) KN motif and ankyrin repeat domains 3
Zebrafish(558407) KN motif and ankyrin repeat domains 3
cow(509964) KN motif and ankyrin repeat domains 3
domestic cat(101093419) KN motif and ankyrin repeat domains 3
dog(476723) KN motif and ankyrin repeat domains 3
sheep(101104065) KN motif and ankyrin repeat domains 3
Domestic Rabbit(100358825) KN motif and ankyrin repeat domains 3
domestic guinea pig(100713417) KN motif and ankyrin repeat domains 3
naked mole-rat(101716931) KN motif and ankyrin repeat domains 3
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103709 Anti-ANKRD47, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, rabbit, human, mouse, canine, bovine, guinea pig
western blot pricing
SAB2103710 Anti-ANKRD47, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, rabbit, rat, bovine, human, guinea pig
western blot pricing
HPA051153 Anti-KANK3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500958 Anti-KANK3 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198471 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198471 Rosetta Predictions human pricing
NM_001108989 Rosetta Predictions rat pricing
NM_030697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062795 predicted 2271
2 SASI_Hs01_00062796 predicted 2254
3 SASI_Hs01_00062798 predicted 2081
4 SASI_Hs01_00062799 predicted 2107
5 SASI_Hs01_00062800 predicted 2187
6 SASI_Hs01_00062802 predicted 2104
7 SASI_Hs01_00062803 predicted 2481
8 SASI_Hs01_00062804 predicted 2518
9 SASI_Hs02_00372003 predicted 2558
10 SASI_Hs02_00372004 predicted 2324
11 SASI_Hs01_00062797 predicted 2322
12 SASI_Hs01_00062801 predicted 2338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244074 predicted 1366
2 SASI_Rn02_00244075 predicted 2255
3 SASI_Rn02_00244076 predicted 2307
4 SASI_Rn02_00244077 predicted 1394
5 SASI_Rn02_00244078 predicted 2026
6 SASI_Rn02_00244079 predicted 2344
7 SASI_Rn02_00244080 predicted 1702
8 SASI_Rn02_00244081 predicted 2239
9 SASI_Rn02_00244082 predicted 2006
10 SASI_Rn02_00244083 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086568 predicted 2230
2 SASI_Mm01_00086569 predicted 1386
3 SASI_Mm01_00086570 predicted 2275
4 SASI_Mm01_00086571 predicted 1372
5 SASI_Mm01_00086572 predicted 2212
6 SASI_Mm01_00086573 predicted 1993
7 SASI_Mm01_00086574 predicted 1251
8 SASI_Mm01_00086575 predicted 1681
9 SASI_Mm01_00086576 predicted 1454
10 SASI_Mm01_00086577 predicted 1767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198471
KANK3 MISSION shRNA Bacterial Glycerol Stock
KN motif and ankyrin repeat domains 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198471.2-1484s21c1
Sequence:CCGATCAACGGAGAGTACGAGAGCTCTCGAGAGCTCTCGTACTCTCCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198471.2-2631s21c1
Sequence:CCGGAGGCTAACACTGGCCGAAGAGCTCGAGCTCTTCGGCCAGTGTTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198471.2-2264s21c1
Sequence:CCGGTGATGTGTGCCAGTGAGTATGCTCGAGCATACTCACTGGCACACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-2118s1c1
Sequence:CCGGCATGGGTGATGTCAATGCCAACTCGAGTTGGCATTGACATCACCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-1398s1c1
Sequence:CCGGCCTCAAATCCATCATGAAGAACTCGAGTTCTTCATGATGGATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-202s1c1
Sequence:CCGGCTGGACTTCCTCAAGTACATACTCGAGTATGTACTTGAGGAAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-213s1c1
Sequence:CCGGCAAGTACATAGAGGAGCTGGACTCGAGTCCAGCTCCTCTATGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-2488s1c1
Sequence:CCGGGAAGGAGAATGCGGTGACAATCTCGAGATTGTCACCGCATTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198471
KANK3 MISSION shRNA shRNA Plasmid DNA
KN motif and ankyrin repeat domains 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198471.2-1484s21c1
Sequence:CCGATCAACGGAGAGTACGAGAGCTCTCGAGAGCTCTCGTACTCTCCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198471.2-2631s21c1
Sequence:CCGGAGGCTAACACTGGCCGAAGAGCTCGAGCTCTTCGGCCAGTGTTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198471.2-2264s21c1
Sequence:CCGGTGATGTGTGCCAGTGAGTATGCTCGAGCATACTCACTGGCACACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-2118s1c1
Sequence:CCGGCATGGGTGATGTCAATGCCAACTCGAGTTGGCATTGACATCACCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-1398s1c1
Sequence:CCGGCCTCAAATCCATCATGAAGAACTCGAGTTCTTCATGATGGATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-202s1c1
Sequence:CCGGCTGGACTTCCTCAAGTACATACTCGAGTATGTACTTGAGGAAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-213s1c1
Sequence:CCGGCAAGTACATAGAGGAGCTGGACTCGAGTCCAGCTCCTCTATGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-2488s1c1
Sequence:CCGGGAAGGAGAATGCGGTGACAATCTCGAGATTGTCACCGCATTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198471
KANK3 MISSION shRNA Lentiviral Transduction Particles
KN motif and ankyrin repeat domains 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198471.2-1484s21c1
Sequence:CCGATCAACGGAGAGTACGAGAGCTCTCGAGAGCTCTCGTACTCTCCGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414539    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198471.2-2631s21c1
Sequence:CCGGAGGCTAACACTGGCCGAAGAGCTCGAGCTCTTCGGCCAGTGTTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198471.2-2264s21c1
Sequence:CCGGTGATGTGTGCCAGTGAGTATGCTCGAGCATACTCACTGGCACACATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-2118s1c1
Sequence:CCGGCATGGGTGATGTCAATGCCAACTCGAGTTGGCATTGACATCACCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153555    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-1398s1c1
Sequence:CCGGCCTCAAATCCATCATGAAGAACTCGAGTTCTTCATGATGGATTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-202s1c1
Sequence:CCGGCTGGACTTCCTCAAGTACATACTCGAGTATGTACTTGAGGAAGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-213s1c1
Sequence:CCGGCAAGTACATAGAGGAGCTGGACTCGAGTCCAGCTCCTCTATGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198471.1-2488s1c1
Sequence:CCGGGAAGGAGAATGCGGTGACAATCTCGAGATTGTCACCGCATTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030697
KANK3 MISSION shRNA Bacterial Glycerol Stock
KN motif and ankyrin repeat domains 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030697.1-2417s1c1
Sequence:CCGGCCCACTGCAAAGGAATGCAATCTCGAGATTGCATTCCTTTGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030697.1-2241s1c1
Sequence:CCGGGACGCCTTGATACAGTTCAATCTCGAGATTGAACTGTATCAAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030697.1-2462s1c1
Sequence:CCGGGTGAGCTGCTAACTACATCTACTCGAGTAGATGTAGTTAGCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030697.1-2287s1c1
Sequence:CCGGCCTAACCATCTTAGACAATGACTCGAGTCATTGTCTAAGATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030697.1-1965s1c1
Sequence:CCGGGTGATGTGAATCACCAGAATACTCGAGTATTCTGGTGATTCACATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030697
KANK3 MISSION shRNA shRNA Plasmid DNA
KN motif and ankyrin repeat domains 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030697.1-2417s1c1
Sequence:CCGGCCCACTGCAAAGGAATGCAATCTCGAGATTGCATTCCTTTGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030697.1-2241s1c1
Sequence:CCGGGACGCCTTGATACAGTTCAATCTCGAGATTGAACTGTATCAAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030697.1-2462s1c1
Sequence:CCGGGTGAGCTGCTAACTACATCTACTCGAGTAGATGTAGTTAGCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030697.1-2287s1c1
Sequence:CCGGCCTAACCATCTTAGACAATGACTCGAGTCATTGTCTAAGATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030697.1-1965s1c1
Sequence:CCGGGTGATGTGAATCACCAGAATACTCGAGTATTCTGGTGATTCACATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030697
KANK3 MISSION shRNA Lentiviral Transduction Particles
KN motif and ankyrin repeat domains 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030697.1-2417s1c1
Sequence:CCGGCCCACTGCAAAGGAATGCAATCTCGAGATTGCATTCCTTTGCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030697.1-2241s1c1
Sequence:CCGGGACGCCTTGATACAGTTCAATCTCGAGATTGAACTGTATCAAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030697.1-2462s1c1
Sequence:CCGGGTGAGCTGCTAACTACATCTACTCGAGTAGATGTAGTTAGCAGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030697.1-2287s1c1
Sequence:CCGGCCTAACCATCTTAGACAATGACTCGAGTCATTGTCTAAGATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030697.1-1965s1c1
Sequence:CCGGGTGATGTGAATCACCAGAATACTCGAGTATTCTGGTGATTCACATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks