EMAIL THIS PAGE TO A FRIEND

KAT2A

K(lysine) acetyltransferase 2A

Synonyms: GCN5 GCN5L2 PCAF-b hGCN5
UniProtKB ID: Q92830, Q8N1A2, Q9UCW1
Gene ID:
Human(2648) Summary: KAT2A, or GCN5, is a histone acetyltransferase (HAT) that functions primarily as a transcriptional activator. It also functions as a repressor of NF-kappa-B (see MIM 164011) by promoting ubiquitination of the NF-kappa-B subunit RELA (MIM 164014) in a HAT-independent manner (Mao et al., 2009 [PubMed 19339690]
Mouse(14534) K(lysine) acetyltransferase 2A
Rat(303539) K(lysine) acetyltransferase 2A
Zebrafish(555517) K(lysine) acetyltransferase 2A
chicken(374232) K(lysine) acetyltransferase 2A
dog(490971) K(lysine) acetyltransferase 2A
domestic cat(101094713) K(lysine) acetyltransferase 2A
cow(514420) K(lysine) acetyltransferase 2A
sheep(101109985) K(lysine) acetyltransferase 2A
domestic guinea pig(100716533) K(lysine) acetyltransferase 2A
naked mole-rat(101724847) K(lysine) acetyltransferase 2A
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Cofactor

Product # Description Species Add to Cart
 
A2181 Acetyl coenzyme A lithium salt ≥93% (HPLC) human, mouse, rat pricing
A2056 Acetyl coenzyme A sodium salt ≥93% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021078 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020004 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020004 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020004 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021078 Rosetta Predictions human pricing
NM_001107050 Rosetta Predictions rat pricing
NM_001038010 Rosetta Predictions mouse pricing
NM_020004 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050954 predicted 2407
2 SASI_Hs01_00050955 predicted 814
3 SASI_Hs01_00050956 predicted 879
4 SASI_Hs01_00050957 predicted 724
5 SASI_Hs01_00050958 predicted 527
6 SASI_Hs01_00050959 predicted 1817
7 SASI_Hs01_00050960 predicted 608
8 SASI_Hs01_00050961 predicted 2517
9 SASI_Hs02_00354568 predicted 644
10 SASI_Hs01_00050962 predicted 1360
11 SASI_Hs01_00050963 predicted 1906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107050 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224996 predicted 558
2 SASI_Rn02_00224997 predicted 575
3 SASI_Rn02_00224998 predicted 1942
4 SASI_Rn02_00224999 predicted 2384
5 SASI_Rn02_00225000 predicted 2079
6 SASI_Rn02_00225001 predicted 650
7 SASI_Rn02_00225002 predicted 2089
8 SASI_Rn02_00225003 predicted 626
9 SASI_Rn02_00225004 predicted 646
10 SASI_Rn02_00225005 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159517 predicted 2217
2 SASI_Mm02_00289578 predicted 606
3 SASI_Mm02_00289579 predicted 626
4 SASI_Mm02_00289580 predicted 780
5 SASI_Mm01_00159518 predicted 1616
6 SASI_Mm01_00159520 predicted 2069
7 SASI_Mm02_00289581 predicted 884
8 SASI_Mm01_00159522 predicted 578
9 SASI_Mm01_00159523 predicted 1807
10 SASI_Mm01_00159525 predicted 2373
11 SASI_Mm01_00159519 predicted 582
12 SASI_Mm01_00159521 predicted 1758
13 SASI_Mm01_00159524 predicted 1712
14 SASI_Mm01_00159526 predicted 2223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020004 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092901 predicted 2217
2 SASI_Mm02_00325361 predicted 611
3 SASI_Mm02_00325362 predicted 626
4 SASI_Mm02_00325363 predicted 782
5 SASI_Mm01_00092902 predicted 1619
6 SASI_Mm01_00092904 predicted 2075
7 SASI_Mm02_00325364 predicted 884
8 SASI_Mm01_00092906 predicted 580
9 SASI_Mm01_00092907 predicted 1814
10 SASI_Mm01_00092909 predicted 2381
11 SASI_Mm01_00092903 predicted 582
12 SASI_Mm01_00092905 predicted 1756
13 SASI_Mm01_00092908 predicted 1715
14 SASI_Mm01_00092910 predicted 2231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021078
VALIDATED
KAT2A MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 2A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021078.2-636s21c1
Sequence:GTACCGGAGACACCAAGCAGGTCTATTTCTCGAGAAATAGACCTGCTTGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-765s21c1
Sequence:CCGGGCTGAACTTTGTGCAGTACAACTCGAGTTGTACTGCACAAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-1848s21c1
Sequence:CCGGCCACCTGAAGGAGTATCACATCTCGAGATGTGATACTCCTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-915s21c1
Sequence:CCGGGGCTACCTACAAGGTCAATTACTCGAGTAATTGACCTTGTAGGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-2873s21c1
Sequence:CCGGGAGCTTTGGAGGCTTGGATTCCTCGAGGAATCCAAGCCTCCAAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-1656s21c1
Sequence:CCGGGCGCATGCCTAAGGAGTATATCTCGAGATATACTCCTTAGGCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_021078.1-2020s1c1
Sequence:CCGGCACATCATCAAGAAGCAGAAACTCGAGTTTCTGCTTCTTGATGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021078.1-729s1c1
Sequence:CCGGGCTGAACTTTGTGCAGTACAACTCGAGTTGTACTGCACAAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021078.1-1812s1c1
Sequence:CCGGCCACCTGAAGGAGTATCACATCTCGAGATGTGATACTCCTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021078.1-693s1c1
Sequence:CCGGCCCTCCATTTGAGAAACCTAACTCGAGTTAGGTTTCTCAAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021078.1-2484s1c1
Sequence:CCGGCCTGGAGAAGTTCTTCTACTTCTCGAGAAGTAGAAGAACTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021078
VALIDATED
KAT2A MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 2A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021078.2-636s21c1
Sequence:GTACCGGAGACACCAAGCAGGTCTATTTCTCGAGAAATAGACCTGCTTGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-765s21c1
Sequence:CCGGGCTGAACTTTGTGCAGTACAACTCGAGTTGTACTGCACAAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-1848s21c1
Sequence:CCGGCCACCTGAAGGAGTATCACATCTCGAGATGTGATACTCCTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-915s21c1
Sequence:CCGGGGCTACCTACAAGGTCAATTACTCGAGTAATTGACCTTGTAGGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-2873s21c1
Sequence:CCGGGAGCTTTGGAGGCTTGGATTCCTCGAGGAATCCAAGCCTCCAAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-1656s21c1
Sequence:CCGGGCGCATGCCTAAGGAGTATATCTCGAGATATACTCCTTAGGCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_021078.1-2020s1c1
Sequence:CCGGCACATCATCAAGAAGCAGAAACTCGAGTTTCTGCTTCTTGATGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021078.1-729s1c1
Sequence:CCGGGCTGAACTTTGTGCAGTACAACTCGAGTTGTACTGCACAAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021078.1-1812s1c1
Sequence:CCGGCCACCTGAAGGAGTATCACATCTCGAGATGTGATACTCCTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021078.1-693s1c1
Sequence:CCGGCCCTCCATTTGAGAAACCTAACTCGAGTTAGGTTTCTCAAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021078.1-2484s1c1
Sequence:CCGGCCTGGAGAAGTTCTTCTACTTCTCGAGAAGTAGAAGAACTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021078
VALIDATED
KAT2A MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 2A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021078.2-636s21c1
Sequence:GTACCGGAGACACCAAGCAGGTCTATTTCTCGAGAAATAGACCTGCTTGGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-765s21c1
Sequence:CCGGGCTGAACTTTGTGCAGTACAACTCGAGTTGTACTGCACAAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-1848s21c1
Sequence:CCGGCCACCTGAAGGAGTATCACATCTCGAGATGTGATACTCCTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-915s21c1
Sequence:CCGGGGCTACCTACAAGGTCAATTACTCGAGTAATTGACCTTGTAGGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-2873s21c1
Sequence:CCGGGAGCTTTGGAGGCTTGGATTCCTCGAGGAATCCAAGCCTCCAAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_021078.2-1656s21c1
Sequence:CCGGGCGCATGCCTAAGGAGTATATCTCGAGATATACTCCTTAGGCATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_021078.1-2020s1c1
Sequence:CCGGCACATCATCAAGAAGCAGAAACTCGAGTTTCTGCTTCTTGATGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021078.1-729s1c1
Sequence:CCGGGCTGAACTTTGTGCAGTACAACTCGAGTTGTACTGCACAAAGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_021078.1-1812s1c1
Sequence:CCGGCCACCTGAAGGAGTATCACATCTCGAGATGTGATACTCCTTCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021078.1-693s1c1
Sequence:CCGGCCCTCCATTTGAGAAACCTAACTCGAGTTAGGTTTCTCAAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_021078.1-2484s1c1
Sequence:CCGGCCTGGAGAAGTTCTTCTACTTCTCGAGAAGTAGAAGAACTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020004
VALIDATED
KAT2A MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 2A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-891s21c1
Sequence:CCGGGCTACCTACAAAGTCAATTATCTCGAGATAATTGACTTTGTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-330s21c1
Sequence:CCGGCGTGCCAAGAAGCTTGAGAAACTCGAGTTTCTCAAGCTTCTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-2046s21c1
Sequence:CCGGGAGATCATCAAGAAGTTGATTCTCGAGAATCAACTTCTTGATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-991s21c1
Sequence:CCGGGAAGCCTTCTACGGTCCATTTCTCGAGAAATGGACCGTAGAAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-1820s21c1
Sequence:CCGGCCTAAAGGAGTACCACATCAACTCGAGTTGATGTGGTACTCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-841s1c1
Sequence:CCGGGCTACCTACAAAGTCAATTATCTCGAGATAATTGACTTTGTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-280s1c1
Sequence:CCGGCGTGCCAAGAAGCTTGAGAAACTCGAGTTTCTCAAGCTTCTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-1770s1c1
Sequence:CCGGCCTAAAGGAGTACCACATCAACTCGAGTTGATGTGGTACTCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-941s1c1
Sequence:CCGGGAAGCCTTCTACGGTCCATTTCTCGAGAAATGGACCGTAGAAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-1996s1c1
Sequence:CCGGGAGATCATCAAGAAGTTGATTCTCGAGAATCAACTTCTTGATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020004
VALIDATED
KAT2A MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 2A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-891s21c1
Sequence:CCGGGCTACCTACAAAGTCAATTATCTCGAGATAATTGACTTTGTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-330s21c1
Sequence:CCGGCGTGCCAAGAAGCTTGAGAAACTCGAGTTTCTCAAGCTTCTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-2046s21c1
Sequence:CCGGGAGATCATCAAGAAGTTGATTCTCGAGAATCAACTTCTTGATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-991s21c1
Sequence:CCGGGAAGCCTTCTACGGTCCATTTCTCGAGAAATGGACCGTAGAAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-1820s21c1
Sequence:CCGGCCTAAAGGAGTACCACATCAACTCGAGTTGATGTGGTACTCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-841s1c1
Sequence:CCGGGCTACCTACAAAGTCAATTATCTCGAGATAATTGACTTTGTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-280s1c1
Sequence:CCGGCGTGCCAAGAAGCTTGAGAAACTCGAGTTTCTCAAGCTTCTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-1770s1c1
Sequence:CCGGCCTAAAGGAGTACCACATCAACTCGAGTTGATGTGGTACTCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-941s1c1
Sequence:CCGGGAAGCCTTCTACGGTCCATTTCTCGAGAAATGGACCGTAGAAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-1996s1c1
Sequence:CCGGGAGATCATCAAGAAGTTGATTCTCGAGAATCAACTTCTTGATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020004
VALIDATED
KAT2A MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 2A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-891s21c1
Sequence:CCGGGCTACCTACAAAGTCAATTATCTCGAGATAATTGACTTTGTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-330s21c1
Sequence:CCGGCGTGCCAAGAAGCTTGAGAAACTCGAGTTTCTCAAGCTTCTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-2046s21c1
Sequence:CCGGGAGATCATCAAGAAGTTGATTCTCGAGAATCAACTTCTTGATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-991s21c1
Sequence:CCGGGAAGCCTTCTACGGTCCATTTCTCGAGAAATGGACCGTAGAAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020004.4-1820s21c1
Sequence:CCGGCCTAAAGGAGTACCACATCAACTCGAGTTGATGTGGTACTCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-841s1c1
Sequence:CCGGGCTACCTACAAAGTCAATTATCTCGAGATAATTGACTTTGTAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-280s1c1
Sequence:CCGGCGTGCCAAGAAGCTTGAGAAACTCGAGTTTCTCAAGCTTCTTGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-1770s1c1
Sequence:CCGGCCTAAAGGAGTACCACATCAACTCGAGTTGATGTGGTACTCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-941s1c1
Sequence:CCGGGAAGCCTTCTACGGTCCATTTCTCGAGAAATGGACCGTAGAAGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020004.1-1996s1c1
Sequence:CCGGGAGATCATCAAGAAGTTGATTCTCGAGAATCAACTTCTTGATGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks