EMAIL THIS PAGE TO A FRIEND

KAT5

K(lysine) acetyltransferase 5

Synonyms: ESA1 HTATIP HTATIP1 PLIP TIP TIP60 ZC2HC5 cPLA2
Gene ID:
Human(10524) Summary: The protein encoded by this gene belongs to the MYST family of histone acetyl transferases (HATs) and was originally isolated as an HIV-1 TAT-interactive protein. HATs play important roles in regulating chromatin remodeling, transcription and other nuclear processes by acetylating histone and nonhistone proteins. This protein is a histone acetylase that has a role in DNA repair and apoptosis and is thought to play an important role in signal transduction. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(81601) K(lysine) acetyltransferase 5
Rat(192218) K(lysine) acetyltransferase 5
chicken(395413) K(lysine) acetyltransferase 5
dog(483728) K(lysine) acetyltransferase 5
domestic cat(101099586) K(lysine) acetyltransferase 5
cow(505619) K(lysine) acetyltransferase 5
domestic guinea pig(100731549) K(lysine) acetyltransferase 5
naked mole-rat(101715110) K(lysine) acetyltransferase 5
Goat(100861366) K(lysine) acetyltransferase 5
sheep(101109495) K(lysine) acetyltransferase 5
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV38791 Anti-HTATIP antibody produced in rabbit affinity isolated antibody zebrafish, mouse, rat, rabbit, canine, bovine, guinea pig, horse, human
immunohistochemistry, western blot pricing
SAB2103488 Anti-HTATIP antibody produced in rabbit affinity isolated antibody zebrafish, mouse, bovine, guinea pig, horse, canine, human, rat, rabbit
western blot pricing
SAB2104133 Anti-HTATIP, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, rat, rabbit, bovine, zebrafish, canine, human, guinea pig, horse
western blot pricing
SAB1407003 Anti-KAT5 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA016953 Anti-KAT5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2106496 Anti-KAT5 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB4504108 Anti-phospho-TIP60 (pSer86) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504732 Anti-phospho-Tip60 (pSer90) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB4301372 Anti-phospho-Tip60 (pSer90) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry pricing
SAB4500117 Anti-TIP60 antibody produced in rabbit affinity isolated antibody mouse, human
immunofluorescence, immunohistochemistry pricing
SAB4500118 Anti-TIP60 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4500119 Anti-TIP60 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB5300083 Monoclonal Anti-KAT5 antibody produced in mouse clone 3F9, ascites fluid human
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Cofactor

Product # Description Species Add to Cart
 
A2181 Acetyl coenzyme A lithium salt ≥93% (HPLC) human, mouse, rat pricing
A2056 Acetyl coenzyme A sodium salt ≥93% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178637 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178637 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178637 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006388 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU139921 MISSION® esiRNA esiRNA human KAT5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006388 Rosetta Predictions human pricing
NM_182709 Rosetta Predictions human pricing
NM_182710 Rosetta Predictions human pricing
NM_001005872 Rosetta Predictions rat pricing
NM_178637 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073301 predicted 1323
2 SASI_Hs01_00073302 predicted 1160
3 SASI_Hs01_00073303 predicted 1656
4 SASI_Hs01_00073304 predicted 1552
5 SASI_Hs01_00073305 predicted 1076
6 SASI_Hs01_00073306 predicted 1063
7 SASI_Hs01_00073307 predicted 1143
8 SASI_Hs01_00073308 predicted 1561
9 SASI_Hs01_00073309 predicted 1566
10 SASI_Hs01_00073310 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239106 predicted 1162
2 SASI_Hs01_00239107 predicted 1010
3 SASI_Hs01_00239108 predicted 1498
4 SASI_Hs01_00239109 predicted 1396
5 SASI_Hs01_00239110 predicted 919
6 SASI_Hs01_00239111 predicted 905
7 SASI_Hs01_00239112 predicted 989
8 SASI_Hs01_00239113 predicted 1402
9 SASI_Hs01_00239114 predicted 1413
10 SASI_Hs01_00239115 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067954 predicted 1422
2 SASI_Hs01_00067955 predicted 1264
3 SASI_Hs01_00067956 predicted 1758
4 SASI_Hs01_00067957 predicted 1651
5 SASI_Hs01_00067958 predicted 1178
6 SASI_Hs01_00067959 predicted 1167
7 SASI_Hs01_00067960 predicted 1245
8 SASI_Hs01_00067961 predicted 1652
9 SASI_Hs01_00067962 predicted 1667
10 SASI_Hs01_00067963 predicted 1365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005872 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096326 predicted 1310
2 SASI_Rn01_00096329 predicted 1144
3 SASI_Rn01_00096331 predicted 687
4 SASI_Rn01_00096332 predicted 695
5 SASI_Rn02_00198444 predicted 1307
6 SASI_Rn02_00198445 predicted 948
7 SASI_Rn01_00096333 predicted 1604
8 SASI_Rn02_00198446 predicted 590
9 SASI_Rn01_00096334 predicted 1331
10 SASI_Rn02_00198447 predicted 572
11 SASI_Rn01_00096327 predicted 1171
12 SASI_Rn01_00096328 predicted 1244
13 SASI_Rn01_00096330 predicted 1230
14 SASI_Rn01_00096335 predicted 1257
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200730 predicted 1163
2 SASI_Mm01_00200731 predicted 1023
3 SASI_Mm01_00200732 predicted 1308
4 SASI_Mm02_00349023 predicted 197
5 SASI_Mm01_00200734 predicted 627
6 SASI_Mm01_00200735 predicted 682
7 SASI_Mm02_00349024 predicted 944
8 SASI_Mm01_00200737 predicted 1071
9 SASI_Mm01_00200738 predicted 1230
10 SASI_Mm02_00349025 predicted 334
11 SASI_Mm01_00200733 predicted 1248
12 SASI_Mm01_00200736 predicted 692
13 SASI_Mm01_00200739 predicted 1250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178637
KAT5 MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178637.1-555s21c1
Sequence:CCGGACGGAAGCGGAAATCTAATTGCTCGAGCAATTAGATTTCCGCTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178637.1-1139s21c1
Sequence:CCGGGCTATGGCAAGCTGCTTATTGCTCGAGCAATAAGCAGCTTGCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178637.1-828s21c1
Sequence:CCGGGCAACGCCACTTGACCAAATGCTCGAGCATTTGGTCAAGTGGCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178637.1-858s21c1
Sequence:CCGGGCACCCTCCAGGCAATGAAATCTCGAGATTTCATTGCCTGGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-1319s1c1
Sequence:CCGGCCATCAATGAGATCAGTGAAACTCGAGTTTCACTGATCTCATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-1230s1c1
Sequence:CCGGCCTCCTATCCTACCGAAGTTACTCGAGTAACTTCGGTAGGATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-145s1c1
Sequence:CCGGGACTTCAACAAACGTCTGGATCTCGAGATCCAGACGTTTGTTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-1025s1c1
Sequence:CCGGCGGAGTATGACTGCAAAGGTTCTCGAGAACCTTTGCAGTCATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-198s1c1
Sequence:CCGGGAAGATCCAATTTCCCAAGAACTCGAGTTCTTGGGAAATTGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178637
KAT5 MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178637.1-555s21c1
Sequence:CCGGACGGAAGCGGAAATCTAATTGCTCGAGCAATTAGATTTCCGCTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178637.1-1139s21c1
Sequence:CCGGGCTATGGCAAGCTGCTTATTGCTCGAGCAATAAGCAGCTTGCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178637.1-828s21c1
Sequence:CCGGGCAACGCCACTTGACCAAATGCTCGAGCATTTGGTCAAGTGGCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178637.1-858s21c1
Sequence:CCGGGCACCCTCCAGGCAATGAAATCTCGAGATTTCATTGCCTGGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-1319s1c1
Sequence:CCGGCCATCAATGAGATCAGTGAAACTCGAGTTTCACTGATCTCATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-1230s1c1
Sequence:CCGGCCTCCTATCCTACCGAAGTTACTCGAGTAACTTCGGTAGGATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-145s1c1
Sequence:CCGGGACTTCAACAAACGTCTGGATCTCGAGATCCAGACGTTTGTTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-1025s1c1
Sequence:CCGGCGGAGTATGACTGCAAAGGTTCTCGAGAACCTTTGCAGTCATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-198s1c1
Sequence:CCGGGAAGATCCAATTTCCCAAGAACTCGAGTTCTTGGGAAATTGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178637
KAT5 MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178637.1-555s21c1
Sequence:CCGGACGGAAGCGGAAATCTAATTGCTCGAGCAATTAGATTTCCGCTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178637.1-1139s21c1
Sequence:CCGGGCTATGGCAAGCTGCTTATTGCTCGAGCAATAAGCAGCTTGCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178637.1-828s21c1
Sequence:CCGGGCAACGCCACTTGACCAAATGCTCGAGCATTTGGTCAAGTGGCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178637.1-858s21c1
Sequence:CCGGGCACCCTCCAGGCAATGAAATCTCGAGATTTCATTGCCTGGAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-1319s1c1
Sequence:CCGGCCATCAATGAGATCAGTGAAACTCGAGTTTCACTGATCTCATTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-1230s1c1
Sequence:CCGGCCTCCTATCCTACCGAAGTTACTCGAGTAACTTCGGTAGGATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-145s1c1
Sequence:CCGGGACTTCAACAAACGTCTGGATCTCGAGATCCAGACGTTTGTTGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-1025s1c1
Sequence:CCGGCGGAGTATGACTGCAAAGGTTCTCGAGAACCTTTGCAGTCATACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178637.1-198s1c1
Sequence:CCGGGAAGATCCAATTTCCCAAGAACTCGAGTTCTTGGGAAATTGGATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006388
VALIDATED
KAT5 MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006388.2-1480s21c1
Sequence:CCGGCCTCCTATCCTATCGAAGCTACTCGAGTAGCTTCGATAGGATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006388.2-1633s21c1
Sequence:CCGGCCTCAATCTCATCAACTACTACTCGAGTAGTAGTTGATGAGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006388.2-1069s21c1
Sequence:CCGGCAAGTGTCTTCAGCGTCATTTCTCGAGAAATGACGCTGAAGACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006388.2-1166s21c1
Sequence:CCGGGGACGTAAGAACAAGAGTTATCTCGAGATAACTCTTGTTCTTACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006388.2-818s21c1
Sequence:CCGGTCGAATTGTTTGGGCACTGATCTCGAGATCAGTGCCCAAACAATTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006388.2-382s1c1
Sequence:CCGGCGTCCATTACATTGACTTCAACTCGAGTTGAAGTCAATGTAATGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006388.2-1480s1c1
Sequence:CCGGCCTCCTATCCTATCGAAGCTACTCGAGTAGCTTCGATAGGATAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006388.2-818s1c1
Sequence:CCGGTCGAATTGTTTGGGCACTGATCTCGAGATCAGTGCCCAAACAATTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006388.2-1219s1c1
Sequence:CCGGCCTTGACCATAAGACACTGTACTCGAGTACAGTGTCTTATGGTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_006388.2-1633s1c1
Sequence:CCGGCCTCAATCTCATCAACTACTACTCGAGTAGTAGTTGATGAGATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006388
VALIDATED
KAT5 MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006388.2-1480s21c1
Sequence:CCGGCCTCCTATCCTATCGAAGCTACTCGAGTAGCTTCGATAGGATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006388.2-1633s21c1
Sequence:CCGGCCTCAATCTCATCAACTACTACTCGAGTAGTAGTTGATGAGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006388.2-1069s21c1
Sequence:CCGGCAAGTGTCTTCAGCGTCATTTCTCGAGAAATGACGCTGAAGACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006388.2-1166s21c1
Sequence:CCGGGGACGTAAGAACAAGAGTTATCTCGAGATAACTCTTGTTCTTACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006388.2-818s21c1
Sequence:CCGGTCGAATTGTTTGGGCACTGATCTCGAGATCAGTGCCCAAACAATTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006388.2-382s1c1
Sequence:CCGGCGTCCATTACATTGACTTCAACTCGAGTTGAAGTCAATGTAATGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006388.2-1480s1c1
Sequence:CCGGCCTCCTATCCTATCGAAGCTACTCGAGTAGCTTCGATAGGATAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006388.2-818s1c1
Sequence:CCGGTCGAATTGTTTGGGCACTGATCTCGAGATCAGTGCCCAAACAATTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006388.2-1219s1c1
Sequence:CCGGCCTTGACCATAAGACACTGTACTCGAGTACAGTGTCTTATGGTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_006388.2-1633s1c1
Sequence:CCGGCCTCAATCTCATCAACTACTACTCGAGTAGTAGTTGATGAGATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006388
VALIDATED
KAT5 MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006388.2-1480s21c1
Sequence:CCGGCCTCCTATCCTATCGAAGCTACTCGAGTAGCTTCGATAGGATAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006388.2-1633s21c1
Sequence:CCGGCCTCAATCTCATCAACTACTACTCGAGTAGTAGTTGATGAGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006388.2-1069s21c1
Sequence:CCGGCAAGTGTCTTCAGCGTCATTTCTCGAGAAATGACGCTGAAGACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006388.2-1166s21c1
Sequence:CCGGGGACGTAAGAACAAGAGTTATCTCGAGATAACTCTTGTTCTTACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006388.2-818s21c1
Sequence:CCGGTCGAATTGTTTGGGCACTGATCTCGAGATCAGTGCCCAAACAATTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006388.2-382s1c1
Sequence:CCGGCGTCCATTACATTGACTTCAACTCGAGTTGAAGTCAATGTAATGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006388.2-1480s1c1
Sequence:CCGGCCTCCTATCCTATCGAAGCTACTCGAGTAGCTTCGATAGGATAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006388.2-818s1c1
Sequence:CCGGTCGAATTGTTTGGGCACTGATCTCGAGATCAGTGCCCAAACAATTCGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006388.2-1219s1c1
Sequence:CCGGCCTTGACCATAAGACACTGTACTCGAGTACAGTGTCTTATGGTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_006388.2-1633s1c1
Sequence:CCGGCCTCAATCTCATCAACTACTACTCGAGTAGTAGTTGATGAGATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks