EMAIL THIS PAGE TO A FRIEND

KAT7

K(lysine) acetyltransferase 7

Synonyms: HBO1 HBOA MYST2 ZC2HC7
Gene ID:
Mouse(217127) K(lysine) acetyltransferase 7
Rat(303470) K (lysine) acetyltransferase 7
Zebrafish(323181) K(lysine) acetyltransferase 7
dog(491072) K(lysine) acetyltransferase 7
cow(508246) K(lysine) acetyltransferase 7
domestic cat(101093559) K(lysine) acetyltransferase 7
sheep(101110071) K(lysine) acetyltransferase 7
domestic guinea pig(100735728) K(lysine) acetyltransferase 7
naked mole-rat(101696684) K(lysine) acetyltransferase 7
180 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306707 ANTI-HBO1/MYST2 (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306619 ANTI-HBO1/MYST2(C-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1306679 ANTI-HBO1/MYST2(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA044470 Anti-KAT7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
AV32842 Anti-MyST2 (AB1) antibody produced in rabbit affinity isolated antibody canine, human, rat, horse, mouse, rabbit, guinea pig, bovine, pig,
western blot pricing
AV38897 Anti-MyST2 (AB2) antibody produced in rabbit affinity isolated antibody human, horse, pig, guinea pig, bovine, canine, mouse, rat, rabbit
western blot pricing
SAB4500219 Anti-MYST2 antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, western blot pricing
SAB1410161 Anti-MYST2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2103446 Anti-MYST2, (N-terminal) antibody produced in rabbit affinity isolated antibody rat, bovine, human, canine, rabbit, mouse, pig, horse, guinea pig
western blot pricing
WH0011143M1 Monoclonal Anti-MYST2 antibody produced in mouse clone 2G5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0246 Rabbit anti-HBO Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. rat, horse, pig, human, guinea pig, toad, chicken, dog, mouse, turkey, bovine, toad, rabbit
immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177619 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177619 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177619 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007067 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007067 Rosetta Predictions human pricing
NM_181081 Rosetta Predictions rat pricing
NM_177619 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342884 predicted 1313
2 SASI_Hs02_00342885 predicted 1307
3 SASI_Hs01_00101002 predicted 288
4 SASI_Hs01_00101004 predicted 1173
5 SASI_Hs02_00342886 predicted 329
6 SASI_Hs02_00342887 predicted 690
7 SASI_Hs02_00342888 predicted 2037
8 SASI_Hs02_00342889 predicted 643
9 SASI_Hs02_00342890 predicted 1282
10 SASI_Hs02_00342891 predicted 1220
11 SASI_Hs01_00100996 predicted 1557
12 SASI_Hs01_00100997 predicted 1001
13 SASI_Hs01_00100998 predicted 1866
14 SASI_Hs01_00100999 predicted 1668
15 SASI_Hs01_00101000 predicted 1224
16 SASI_Hs01_00101001 predicted 1592
17 SASI_Hs01_00101003 predicted 1734
18 SASI_Hs01_00101005 predicted 1035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181081 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109410 predicted 1091
2 SASI_Rn01_00109411 predicted 954
3 SASI_Rn01_00109412 predicted 612
4 SASI_Rn01_00109413 predicted 1503
5 SASI_Rn01_00109414 predicted 1341
6 SASI_Rn01_00109415 predicted 563
7 SASI_Rn01_00109416 predicted 204
8 SASI_Rn01_00109417 predicted 1876
9 SASI_Rn01_00109418 predicted 1231
10 SASI_Rn01_00109419 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188009 predicted 1618
2 SASI_Mm01_00188010 predicted 787
3 SASI_Mm01_00188011 predicted 986
4 SASI_Mm01_00188012 predicted 544
5 SASI_Mm01_00188014 predicted 227
6 SASI_Mm01_00188015 predicted 359
7 SASI_Mm01_00188016 predicted 1061
8 SASI_Mm01_00188017 predicted 1166
9 SASI_Mm01_00188018 predicted 691
10 SASI_Mm02_00347853 predicted 1031
11 SASI_Mm01_00188013 predicted 1237
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177619
VALIDATED
KAT7 MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 7
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177619.2-2374s1c1
Sequence:CCGGCCCATGCTTTCCTTTGTATTTCTCGAGAAATACAAAGGAAAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177619.2-503s1c1
Sequence:CCGGCGAAAGCTACAATTTCAACATCTCGAGATGTTGAAATTGTAGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177619.2-1620s1c1
Sequence:CCGGGACCTGATAGATGAGTGGATACTCGAGTATCCACTCATCTATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177619.2-785s1c1
Sequence:CCGGCCTGACAAGTGAATATGACTTCTCGAGAAGTCATATTCACTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177619.2-1566s1c1
Sequence:CCGGGCCCTTCAGATGCTCAAGTATCTCGAGATACTTGAGCATCTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177619.2-648s21c1
Sequence:CCGGGAGAGACAGCTGCGGTATAAGCTCGAGCTTATACCGCAGCTGTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177619.2-1174s21c1
Sequence:CCGGACCATAAGACGCTATACTATGCTCGAGCATAGTATAGCGTCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177619.2-1219s21c1
Sequence:CCGGTTATGACAGAAGCGGACAATACTCGAGTATTGTCCGCTTCTGTCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177619.2-351s21c1
Sequence:CCGGCCTCGAACTCCAACCGGAAATCTCGAGATTTCCGGTTGGAGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177619.2-191s21c1
Sequence:CCGGTGGAACCGAAGATTCCGATTTCTCGAGAAATCGGAATCTTCGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177619.2-1948s21c1
Sequence:CCGGTCGAGTACAGATCCCTCATAGCTCGAGCTATGAGGGATCTGTACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177619
VALIDATED
KAT7 MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 7
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177619.2-2374s1c1
Sequence:CCGGCCCATGCTTTCCTTTGTATTTCTCGAGAAATACAAAGGAAAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177619.2-503s1c1
Sequence:CCGGCGAAAGCTACAATTTCAACATCTCGAGATGTTGAAATTGTAGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177619.2-1620s1c1
Sequence:CCGGGACCTGATAGATGAGTGGATACTCGAGTATCCACTCATCTATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177619.2-785s1c1
Sequence:CCGGCCTGACAAGTGAATATGACTTCTCGAGAAGTCATATTCACTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177619.2-1566s1c1
Sequence:CCGGGCCCTTCAGATGCTCAAGTATCTCGAGATACTTGAGCATCTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177619.2-648s21c1
Sequence:CCGGGAGAGACAGCTGCGGTATAAGCTCGAGCTTATACCGCAGCTGTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177619.2-1174s21c1
Sequence:CCGGACCATAAGACGCTATACTATGCTCGAGCATAGTATAGCGTCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177619.2-1219s21c1
Sequence:CCGGTTATGACAGAAGCGGACAATACTCGAGTATTGTCCGCTTCTGTCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177619.2-351s21c1
Sequence:CCGGCCTCGAACTCCAACCGGAAATCTCGAGATTTCCGGTTGGAGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177619.2-191s21c1
Sequence:CCGGTGGAACCGAAGATTCCGATTTCTCGAGAAATCGGAATCTTCGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177619.2-1948s21c1
Sequence:CCGGTCGAGTACAGATCCCTCATAGCTCGAGCTATGAGGGATCTGTACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177619
VALIDATED
KAT7 MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 7
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177619.2-2374s1c1
Sequence:CCGGCCCATGCTTTCCTTTGTATTTCTCGAGAAATACAAAGGAAAGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177619.2-503s1c1
Sequence:CCGGCGAAAGCTACAATTTCAACATCTCGAGATGTTGAAATTGTAGCTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177619.2-1620s1c1
Sequence:CCGGGACCTGATAGATGAGTGGATACTCGAGTATCCACTCATCTATCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177619.2-785s1c1
Sequence:CCGGCCTGACAAGTGAATATGACTTCTCGAGAAGTCATATTCACTTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_177619.2-1566s1c1
Sequence:CCGGGCCCTTCAGATGCTCAAGTATCTCGAGATACTTGAGCATCTGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177619.2-648s21c1
Sequence:CCGGGAGAGACAGCTGCGGTATAAGCTCGAGCTTATACCGCAGCTGTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177619.2-1174s21c1
Sequence:CCGGACCATAAGACGCTATACTATGCTCGAGCATAGTATAGCGTCTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177619.2-1219s21c1
Sequence:CCGGTTATGACAGAAGCGGACAATACTCGAGTATTGTCCGCTTCTGTCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177619.2-351s21c1
Sequence:CCGGCCTCGAACTCCAACCGGAAATCTCGAGATTTCCGGTTGGAGTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_177619.2-191s21c1
Sequence:CCGGTGGAACCGAAGATTCCGATTTCTCGAGAAATCGGAATCTTCGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374846    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177619.2-1948s21c1
Sequence:CCGGTCGAGTACAGATCCCTCATAGCTCGAGCTATGAGGGATCTGTACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007067
VALIDATED
KAT7 MISSION shRNA Bacterial Glycerol Stock
K(lysine) acetyltransferase 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007067.3-525s1c1
Sequence:CCGGGCCTTCTTCTGAGTCTGACATCTCGAGATGTCAGACTCAGAAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007067.3-695s1c1
Sequence:CCGGGTAACTCTCTAGGACACCTTACTCGAGTAAGGTGTCCTAGAGAGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_007067.3-416s1c1
Sequence:CCGGCTCGTTCATCTGGTTCAGAAACTCGAGTTTCTGAACCAGATGAACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_007067.3-805s1c1
Sequence:CCGGCGGGATAAGCAGATAGAAGAACTCGAGTTCTTCTATCTGCTTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007067.3-1818s1c1
Sequence:CCGGGCTCAAATACTGGAAGGGAAACTCGAGTTTCCCTTCCAGTATTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007067.3-2575s21c1
Sequence:CCGGGTCATGGTAATAGCATATAATCTCGAGATTATATGCTATTACCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007067.3-1485s21c1
Sequence:CCGGCTGTCACCTGATTGGATATTTCTCGAGAAATATCCAATCAGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007067.3-888s21c1
Sequence:CCGGGGAGAGGCAGCTTCGATATAACTCGAGTTATATCGAAGCTGCCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007067.3-289s21c1
Sequence:CCGGGATTCCAGTCCTGTTCGAAATCTCGAGATTTCGAACAGGACTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007067.3-165s21c1
Sequence:CCGGTGGAACCGAAGATTCCGATTTCTCGAGAAATCGGAATCTTCGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007067
VALIDATED
KAT7 MISSION shRNA shRNA Plasmid DNA
K(lysine) acetyltransferase 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007067.3-525s1c1
Sequence:CCGGGCCTTCTTCTGAGTCTGACATCTCGAGATGTCAGACTCAGAAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007067.3-695s1c1
Sequence:CCGGGTAACTCTCTAGGACACCTTACTCGAGTAAGGTGTCCTAGAGAGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_007067.3-416s1c1
Sequence:CCGGCTCGTTCATCTGGTTCAGAAACTCGAGTTTCTGAACCAGATGAACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_007067.3-805s1c1
Sequence:CCGGCGGGATAAGCAGATAGAAGAACTCGAGTTCTTCTATCTGCTTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007067.3-1818s1c1
Sequence:CCGGGCTCAAATACTGGAAGGGAAACTCGAGTTTCCCTTCCAGTATTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007067.3-2575s21c1
Sequence:CCGGGTCATGGTAATAGCATATAATCTCGAGATTATATGCTATTACCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007067.3-1485s21c1
Sequence:CCGGCTGTCACCTGATTGGATATTTCTCGAGAAATATCCAATCAGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007067.3-888s21c1
Sequence:CCGGGGAGAGGCAGCTTCGATATAACTCGAGTTATATCGAAGCTGCCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007067.3-289s21c1
Sequence:CCGGGATTCCAGTCCTGTTCGAAATCTCGAGATTTCGAACAGGACTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007067.3-165s21c1
Sequence:CCGGTGGAACCGAAGATTCCGATTTCTCGAGAAATCGGAATCTTCGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007067
VALIDATED
KAT7 MISSION shRNA Lentiviral Transduction Particles
K(lysine) acetyltransferase 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007067.3-525s1c1
Sequence:CCGGGCCTTCTTCTGAGTCTGACATCTCGAGATGTCAGACTCAGAAGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007067.3-695s1c1
Sequence:CCGGGTAACTCTCTAGGACACCTTACTCGAGTAAGGTGTCCTAGAGAGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_007067.3-416s1c1
Sequence:CCGGCTCGTTCATCTGGTTCAGAAACTCGAGTTTCTGAACCAGATGAACGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_007067.3-805s1c1
Sequence:CCGGCGGGATAAGCAGATAGAAGAACTCGAGTTCTTCTATCTGCTTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007067.3-1818s1c1
Sequence:CCGGGCTCAAATACTGGAAGGGAAACTCGAGTTTCCCTTCCAGTATTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007067.3-2575s21c1
Sequence:CCGGGTCATGGTAATAGCATATAATCTCGAGATTATATGCTATTACCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007067.3-1485s21c1
Sequence:CCGGCTGTCACCTGATTGGATATTTCTCGAGAAATATCCAATCAGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007067.3-888s21c1
Sequence:CCGGGGAGAGGCAGCTTCGATATAACTCGAGTTATATCGAAGCTGCCTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007067.3-289s21c1
Sequence:CCGGGATTCCAGTCCTGTTCGAAATCTCGAGATTTCGAACAGGACTGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007067.3-165s21c1
Sequence:CCGGTGGAACCGAAGATTCCGATTTCTCGAGAAATCGGAATCTTCGGTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks