EMAIL THIS PAGE TO A FRIEND

KATNAL2

katanin p60 subunit A-like 2

UniProtKB ID: Q8IYT4
Gene ID:
Mouse(71206) katanin p60 subunit A-like 2
Rat(307253) katanin p60 subunit A-like 2
Zebrafish(641431) katanin p60 subunit A-like 2
cow(514354) katanin p60 subunit A-like 2
Horse(100068896) katanin p60 subunit A-like 2
chicken(416384) katanin p60 subunit A-like 2
dog(490465) katanin p60 subunit A-like 2
domestic cat(101086184) katanin p60 subunit A-like 2
sheep(101113378) katanin p60 subunit A-like 2
Domestic Rabbit(100358099) katanin p60 subunit A-like 2
domestic guinea pig(100727791) katanin p60 subunit A-like 2
naked mole-rat(101711571) katanin p60 subunit A-like 2
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031303 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090021 MISSION® esiRNA esiRNA human KATNAL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031303 Rosetta Predictions human pricing
XM_001055413 Rosetta Predictions rat pricing
XM_225707 Rosetta Predictions rat pricing
NM_027721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130521 predicted 399
2 SASI_Hs01_00130522 predicted 1624
3 SASI_Hs01_00130523 predicted 708
4 SASI_Hs01_00130524 predicted 393
5 SASI_Hs01_00130525 predicted 1459
6 SASI_Hs01_00130526 predicted 784
7 SASI_Hs01_00130527 predicted 1105
8 SASI_Hs02_00358748 predicted 864
9 SASI_Hs01_00130528 predicted 628
10 SASI_Hs02_00358749 predicted 537
11 SASI_Hs01_00130529 predicted 729
12 SASI_Hs01_00130530 predicted 1448
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279418 predicted 224
2 SASI_Rn02_00279419 predicted 844
3 SASI_Rn02_00279420 predicted 321
4 SASI_Rn02_00279421 predicted 904
5 SASI_Rn02_00279422 predicted 859
6 SASI_Rn02_00279423 predicted 1139
7 SASI_Rn02_00279424 predicted 207
8 SASI_Rn02_00279425 predicted 936
9 SASI_Rn02_00279426 predicted 325
10 SASI_Rn02_00279427 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383084 predicted 318
2 SASI_Rn02_00383085 predicted 900
3 SASI_Rn02_00383086 predicted 992
4 SASI_Rn02_00383087 predicted 1583
5 SASI_Rn02_00383088 predicted 683
6 SASI_Rn02_00383089 predicted 1492
7 SASI_Rn02_00383090 predicted 858
8 SASI_Rn02_00383091 predicted 1670
9 SASI_Rn02_00383092 predicted 1142
10 SASI_Rn02_00383093 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163857 predicted 1085
2 SASI_Mm01_00163858 predicted 742
3 SASI_Mm01_00163860 predicted 805
4 SASI_Mm01_00163861 predicted 670
5 SASI_Mm01_00163862 predicted 901
6 SASI_Mm01_00163863 predicted 288
7 SASI_Mm01_00163864 predicted 828
8 SASI_Mm01_00163865 predicted 407
9 SASI_Mm01_00163866 predicted 258
10 SASI_Mm02_00332650 predicted 624
11 SASI_Mm01_00163859 predicted 293
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031303
KATNAL2 MISSION shRNA Bacterial Glycerol Stock
katanin p60 subunit A-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031303.1-1713s1c1
Sequence:CCGGGATTAACTTGAGCCACTGTATCTCGAGATACAGTGGCTCAAGTTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031303.1-807s1c1
Sequence:CCGGCCACAGCTATTTACAGGAATTCTCGAGAATTCCTGTAAATAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031303.1-1143s1c1
Sequence:CCGGCGCTCAGAAGATCTCGTATTTCTCGAGAAATACGAGATCTTCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031303.1-786s1c1
Sequence:CCGGGTTGTGTATCCTATAAGGTATCTCGAGATACCTTATAGGATACACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031303.1-404s1c1
Sequence:CCGGGCTCAATAAGGAGCATCCTAACTCGAGTTAGGATGCTCCTTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031303
KATNAL2 MISSION shRNA shRNA Plasmid DNA
katanin p60 subunit A-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031303.1-1713s1c1
Sequence:CCGGGATTAACTTGAGCCACTGTATCTCGAGATACAGTGGCTCAAGTTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031303.1-807s1c1
Sequence:CCGGCCACAGCTATTTACAGGAATTCTCGAGAATTCCTGTAAATAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031303.1-1143s1c1
Sequence:CCGGCGCTCAGAAGATCTCGTATTTCTCGAGAAATACGAGATCTTCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031303.1-786s1c1
Sequence:CCGGGTTGTGTATCCTATAAGGTATCTCGAGATACCTTATAGGATACACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031303.1-404s1c1
Sequence:CCGGGCTCAATAAGGAGCATCCTAACTCGAGTTAGGATGCTCCTTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031303
KATNAL2 MISSION shRNA Lentiviral Transduction Particles
katanin p60 subunit A-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117302    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031303.1-1713s1c1
Sequence:CCGGGATTAACTTGAGCCACTGTATCTCGAGATACAGTGGCTCAAGTTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031303.1-807s1c1
Sequence:CCGGCCACAGCTATTTACAGGAATTCTCGAGAATTCCTGTAAATAGCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031303.1-1143s1c1
Sequence:CCGGCGCTCAGAAGATCTCGTATTTCTCGAGAAATACGAGATCTTCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031303.1-786s1c1
Sequence:CCGGGTTGTGTATCCTATAAGGTATCTCGAGATACCTTATAGGATACACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031303.1-404s1c1
Sequence:CCGGGCTCAATAAGGAGCATCCTAACTCGAGTTAGGATGCTCCTTATTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027721
KATNAL2 MISSION shRNA Bacterial Glycerol Stock
katanin p60 subunit A-like 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027721.1-1325s1c1
Sequence:CCGGCCAGGGTCAAGAGAAGCAAATCTCGAGATTTGCTTCTCTTGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027721.1-800s1c1
Sequence:CCGGCGGGACATTTATCTCCATAATCTCGAGATTATGGAGATAAATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027721.1-1087s1c1
Sequence:CCGGGCTGTTTGAACTTGCGCGATACTCGAGTATCGCGCAAGTTCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027721.1-1195s1c1
Sequence:CCGGCCTTCGGATGAAGACGGAGTTCTCGAGAACTCCGTCTTCATCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027721.1-1196s1c1
Sequence:CCGGCTTCGGATGAAGACGGAGTTACTCGAGTAACTCCGTCTTCATCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027721.2-879s21c1
Sequence:CCGGAGCCGTTGTGTACCCAATAAGCTCGAGCTTATTGGGTACACAACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027721.2-291s21c1
Sequence:CCGGGGAATATGAGAGCTATTATTTCTCGAGAAATAATAGCTCTCATATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027721.2-445s21c1
Sequence:CCGGCACCAGAAGTCACGACCTAAACTCGAGTTTAGGTCGTGACTTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027721.2-266s21c1
Sequence:CCGGACGTTGACCTGGAAACTATTTCTCGAGAAATAGTTTCCAGGTCAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027721
KATNAL2 MISSION shRNA shRNA Plasmid DNA
katanin p60 subunit A-like 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027721.1-1325s1c1
Sequence:CCGGCCAGGGTCAAGAGAAGCAAATCTCGAGATTTGCTTCTCTTGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027721.1-800s1c1
Sequence:CCGGCGGGACATTTATCTCCATAATCTCGAGATTATGGAGATAAATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027721.1-1087s1c1
Sequence:CCGGGCTGTTTGAACTTGCGCGATACTCGAGTATCGCGCAAGTTCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027721.1-1195s1c1
Sequence:CCGGCCTTCGGATGAAGACGGAGTTCTCGAGAACTCCGTCTTCATCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027721.1-1196s1c1
Sequence:CCGGCTTCGGATGAAGACGGAGTTACTCGAGTAACTCCGTCTTCATCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027721.2-879s21c1
Sequence:CCGGAGCCGTTGTGTACCCAATAAGCTCGAGCTTATTGGGTACACAACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027721.2-291s21c1
Sequence:CCGGGGAATATGAGAGCTATTATTTCTCGAGAAATAATAGCTCTCATATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027721.2-445s21c1
Sequence:CCGGCACCAGAAGTCACGACCTAAACTCGAGTTTAGGTCGTGACTTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027721.2-266s21c1
Sequence:CCGGACGTTGACCTGGAAACTATTTCTCGAGAAATAGTTTCCAGGTCAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027721
KATNAL2 MISSION shRNA Lentiviral Transduction Particles
katanin p60 subunit A-like 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027721.1-1325s1c1
Sequence:CCGGCCAGGGTCAAGAGAAGCAAATCTCGAGATTTGCTTCTCTTGACCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027721.1-800s1c1
Sequence:CCGGCGGGACATTTATCTCCATAATCTCGAGATTATGGAGATAAATGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027721.1-1087s1c1
Sequence:CCGGGCTGTTTGAACTTGCGCGATACTCGAGTATCGCGCAAGTTCAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027721.1-1195s1c1
Sequence:CCGGCCTTCGGATGAAGACGGAGTTCTCGAGAACTCCGTCTTCATCCGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027721.1-1196s1c1
Sequence:CCGGCTTCGGATGAAGACGGAGTTACTCGAGTAACTCCGTCTTCATCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027721.2-879s21c1
Sequence:CCGGAGCCGTTGTGTACCCAATAAGCTCGAGCTTATTGGGTACACAACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027721.2-291s21c1
Sequence:CCGGGGAATATGAGAGCTATTATTTCTCGAGAAATAATAGCTCTCATATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027721.2-445s21c1
Sequence:CCGGCACCAGAAGTCACGACCTAAACTCGAGTTTAGGTCGTGACTTCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027721.2-266s21c1
Sequence:CCGGACGTTGACCTGGAAACTATTTCTCGAGAAATAGTTTCCAGGTCAACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks