EMAIL THIS PAGE TO A FRIEND

KAZN

kazrin, periplakin interacting protein

Synonyms: KAZ
Gene ID:
Human(23254) Summary: This gene encodes a protein that plays a role in desmosome assembly, cell adhesion, cytoskeletal organization, and epidermal differentiation. This protein co-localizes with desmoplakin and the cytolinker protein periplakin. In general, this protein localizes to the nucleus, desmosomes, cell membrane, and cortical actin-based structures. Some isoforms of this protein also associate with microtubules. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity has not been verified. [provided by RefSeq, Aug 2011]
Mouse(71529) kazrin, periplakin interacting protein
Rat(313672) kazrin, periplakin interacting protein
chicken(426211) kazrin, periplakin interacting protein
Horse(100054647) kazrin, periplakin interacting protein
cow(100298347) kazrin, periplakin interacting protein
dog(607338) kazrin, periplakin interacting protein
sheep(101110432) kazrin, periplakin interacting protein
domestic guinea pig(100733889) kazrin, periplakin interacting protein
naked mole-rat(101700657) kazrin, periplakin interacting protein
242 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_201628 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_201628 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_201628 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015209 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144531 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144531 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144531 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU039861 MISSION® esiRNA esiRNA targeting mouse 9030409G11Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017999 Rosetta Predictions human pricing
NM_001018000 Rosetta Predictions human pricing
NM_001018001 Rosetta Predictions human pricing
NM_015209 Rosetta Predictions human pricing
NM_201628 Rosetta Predictions human pricing
NM_001014070 Rosetta Predictions rat pricing
NM_001109684 Rosetta Predictions mouse pricing
NM_001109685 Rosetta Predictions mouse pricing
NM_144531 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125564 predicted 588
2 SASI_Hs01_00125565 predicted 548
3 SASI_Hs01_00125566 predicted 547
4 SASI_Hs01_00125568 predicted 746
5 SASI_Hs01_00125569 predicted 756
6 SASI_Hs01_00125570 predicted 759
7 SASI_Hs01_00125572 predicted 871
8 SASI_Hs01_00125573 predicted 457
9 SASI_Hs02_00306884 predicted 704
10 SASI_Hs02_00306885 predicted 893
11 SASI_Hs01_00125567 predicted 678
12 SASI_Hs01_00125571 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018000 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168002 predicted 785
2 SASI_Hs01_00168003 predicted 735
3 SASI_Hs01_00168004 predicted 738
4 SASI_Hs01_00168006 predicted 944
5 SASI_Hs01_00168007 predicted 948
6 SASI_Hs01_00168008 predicted 954
7 SASI_Hs01_00168010 predicted 1066
8 SASI_Hs01_00168011 predicted 654
9 SASI_Hs02_00306890 predicted 887
10 SASI_Hs02_00306891 predicted 1076
11 SASI_Hs01_00168005 predicted 859
12 SASI_Hs01_00168009 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111994 predicted 585
2 SASI_Hs01_00111995 predicted 536
3 SASI_Hs01_00111996 predicted 532
4 SASI_Hs01_00111998 predicted 745
5 SASI_Hs01_00111999 predicted 745
6 SASI_Hs01_00112000 predicted 746
7 SASI_Hs01_00112002 predicted 864
8 SASI_Hs01_00112003 predicted 447
9 SASI_Hs02_00306892 predicted 697
10 SASI_Hs02_00306893 predicted 875
11 SASI_Hs01_00111997 predicted 662
12 SASI_Hs01_00112001 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00232337 predicted 848
2 SASI_Hs01_00232338 predicted 792
3 SASI_Hs01_00232339 predicted 800
4 SASI_Hs01_00232341 predicted 1006
5 SASI_Hs01_00232342 predicted 1013
6 SASI_Hs01_00232343 predicted 1009
7 SASI_Hs01_00232345 predicted 1129
8 SASI_Hs01_00232346 predicted 718
9 SASI_Hs02_00347318 predicted 952
10 SASI_Hs02_00347319 predicted 1139
11 SASI_Hs01_00232340 predicted 852
12 SASI_Hs01_00232344 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373135 predicted 843
2 SASI_Hs02_00373136 predicted 800
3 SASI_Hs02_00373137 predicted 801
4 SASI_Hs02_00373138 predicted 1001
5 SASI_Hs02_00373139 predicted 1009
6 SASI_Hs02_00373140 predicted 1016
7 SASI_Hs02_00373141 predicted 1124
8 SASI_Hs02_00373142 predicted 710
9 SASI_Hs02_00373143 predicted 952
10 SASI_Hs02_00373144 predicted 1137
11 SASI_Hs01_00091961 predicted 706
12 SASI_Hs01_00091962 predicted 229
13 SASI_Hs01_00091963 predicted 787
14 SASI_Hs01_00091964 predicted 615
15 SASI_Hs01_00091965 predicted 591
16 SASI_Hs01_00091966 predicted 414
17 SASI_Hs01_00091967 predicted 1190
18 SASI_Hs01_00091968 predicted 1009
19 SASI_Hs01_00091969 predicted 641
20 SASI_Hs01_00091970 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037970 predicted 698
2 SASI_Rn01_00037971 predicted 1258
3 SASI_Rn01_00037972 predicted 1266
4 SASI_Rn01_00037973 predicted 914
5 SASI_Rn01_00037975 predicted 1247
6 SASI_Rn01_00037976 predicted 1043
7 SASI_Rn01_00037977 predicted 816
8 SASI_Rn01_00037978 predicted 897
9 SASI_Rn01_00037979 predicted 527
10 SASI_Rn02_00201474 predicted 503
11 SASI_Rn01_00037974 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304124 predicted 689
2 SASI_Mm02_00304125 predicted 728
3 SASI_Mm02_00304126 predicted 726
4 SASI_Mm02_00304127 predicted 896
5 SASI_Mm02_00304128 predicted 788
6 SASI_Mm02_00304129 predicted 1148
7 SASI_Mm02_00304130 predicted 785
8 SASI_Mm02_00304131 predicted 610
9 SASI_Mm02_00304132 predicted 772
10 SASI_Mm02_00304133 predicted 1045
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304134 predicted 709
2 SASI_Mm02_00304135 predicted 1266
3 SASI_Mm02_00304136 predicted 744
4 SASI_Mm02_00304137 predicted 502
5 SASI_Mm02_00304138 predicted 1213
6 SASI_Mm02_00304139 predicted 739
7 SASI_Mm02_00304140 predicted 911
8 SASI_Mm02_00304141 predicted 1248
9 SASI_Mm02_00304142 predicted 426
10 SASI_Mm02_00304143 predicted 1160
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144531 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340055 predicted 684
2 SASI_Mm02_00340056 predicted 724
3 SASI_Mm02_00340057 predicted 725
4 SASI_Mm02_00340058 predicted 894
5 SASI_Mm02_00340059 predicted 786
6 SASI_Mm02_00340060 predicted 1140
7 SASI_Mm02_00340061 predicted 788
8 SASI_Mm02_00340062 predicted 608
9 SASI_Mm02_00340063 predicted 772
10 SASI_Mm02_00340064 predicted 1044
11 SASI_Mm01_00071208 predicted 468
12 SASI_Mm01_00071209 predicted 1011
13 SASI_Mm01_00071210 predicted 1137
14 SASI_Mm01_00071211 predicted 484
15 SASI_Mm01_00071212 predicted 1213
16 SASI_Mm01_00071213 predicted 1619
17 SASI_Mm01_00071214 predicted 1605
18 SASI_Mm01_00071215 predicted 554
19 SASI_Mm01_00071216 predicted 1054
20 SASI_Mm01_00071217 predicted 1150
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201628
KAZN MISSION shRNA Bacterial Glycerol Stock
kazrin, periplakin interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201628.1-1893s1c1
Sequence:CCGGCGTGAGGATTAACACTTGCTACTCGAGTAGCAAGTGTTAATCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-610s1c1
Sequence:CCGGCATGATGACTATGGCTCTCTTCTCGAGAAGAGAGCCATAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-601s1c1
Sequence:CCGGCCCGATTTCCATGATGACTATCTCGAGATAGTCATCATGGAAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-144s1c1
Sequence:CCGGGCTGCTGTACCAAGTGAACTTCTCGAGAAGTTCACTTGGTACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201628.1-2159s1c1
Sequence:CCGGGCCTCAGTTCATTGACCAGATCTCGAGATCTGGTCAATGAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201628.1-3252s1c1
Sequence:CCGGGCAGAGAGACTCAAGCTGATTCTCGAGAATCAGCTTGAGTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201628.1-2920s1c1
Sequence:CCGGGCTGGAGACAAGTGGACAATTCTCGAGAATTGTCCACTTGTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-94s1c1
Sequence:CCGGCTGAACGTGTCCAAGAAGTTCCTCGAGGAACTTCTTGGACACGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201628.1-588s1c1
Sequence:CCGGCAGCAGCAAAGATCCCGATTTCTCGAGAAATCGGGATCTTTGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-609s1c1
Sequence:CCGGCCATGATGACTATGGCTCTCTCTCGAGAGAGAGCCATAGTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201628
KAZN MISSION shRNA shRNA Plasmid DNA
kazrin, periplakin interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201628.1-1893s1c1
Sequence:CCGGCGTGAGGATTAACACTTGCTACTCGAGTAGCAAGTGTTAATCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-610s1c1
Sequence:CCGGCATGATGACTATGGCTCTCTTCTCGAGAAGAGAGCCATAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-601s1c1
Sequence:CCGGCCCGATTTCCATGATGACTATCTCGAGATAGTCATCATGGAAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-144s1c1
Sequence:CCGGGCTGCTGTACCAAGTGAACTTCTCGAGAAGTTCACTTGGTACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201628.1-2159s1c1
Sequence:CCGGGCCTCAGTTCATTGACCAGATCTCGAGATCTGGTCAATGAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201628.1-3252s1c1
Sequence:CCGGGCAGAGAGACTCAAGCTGATTCTCGAGAATCAGCTTGAGTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201628.1-2920s1c1
Sequence:CCGGGCTGGAGACAAGTGGACAATTCTCGAGAATTGTCCACTTGTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-94s1c1
Sequence:CCGGCTGAACGTGTCCAAGAAGTTCCTCGAGGAACTTCTTGGACACGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201628.1-588s1c1
Sequence:CCGGCAGCAGCAAAGATCCCGATTTCTCGAGAAATCGGGATCTTTGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-609s1c1
Sequence:CCGGCCATGATGACTATGGCTCTCTCTCGAGAGAGAGCCATAGTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201628
KAZN MISSION shRNA Lentiviral Transduction Particles
kazrin, periplakin interacting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153885    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201628.1-1893s1c1
Sequence:CCGGCGTGAGGATTAACACTTGCTACTCGAGTAGCAAGTGTTAATCCTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-610s1c1
Sequence:CCGGCATGATGACTATGGCTCTCTTCTCGAGAAGAGAGCCATAGTCATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-601s1c1
Sequence:CCGGCCCGATTTCCATGATGACTATCTCGAGATAGTCATCATGGAAATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156818    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-144s1c1
Sequence:CCGGGCTGCTGTACCAAGTGAACTTCTCGAGAAGTTCACTTGGTACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156974    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201628.1-2159s1c1
Sequence:CCGGGCCTCAGTTCATTGACCAGATCTCGAGATCTGGTCAATGAACTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201628.1-3252s1c1
Sequence:CCGGGCAGAGAGACTCAAGCTGATTCTCGAGAATCAGCTTGAGTCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157507    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201628.1-2920s1c1
Sequence:CCGGGCTGGAGACAAGTGGACAATTCTCGAGAATTGTCCACTTGTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-94s1c1
Sequence:CCGGCTGAACGTGTCCAAGAAGTTCCTCGAGGAACTTCTTGGACACGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201628.1-588s1c1
Sequence:CCGGCAGCAGCAAAGATCCCGATTTCTCGAGAAATCGGGATCTTTGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_201628.1-609s1c1
Sequence:CCGGCCATGATGACTATGGCTCTCTCTCGAGAGAGAGCCATAGTCATCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015209
KAZN MISSION shRNA Bacterial Glycerol Stock
kazrin, periplakin interacting protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1273s1c1
Sequence:CCGGCAGTTCAGAAGAACCTGCACACTCGAGTGTGCAGGTTCTTCTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-729s1c1
Sequence:CCGGCGAGACTTCATCCGCAACTATCTCGAGATAGTTGCGGATGAAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1302s1c1
Sequence:CCGGGTACAGTCACTAGAGGATCTTCTCGAGAAGATCCTCTAGTGACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1292s1c1
Sequence:CCGGCAACCCTATTGTACAGTCACTCTCGAGAGTGACTGTACAATAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1295s1c1
Sequence:CCGGCCCTATTGTACAGTCACTAGACTCGAGTCTAGTGACTGTACAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1070s1c1
Sequence:CCGGGCAGAGTCAACAGACTCTCTACTCGAGTAGAGAGTCTGTTGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1073s1c1
Sequence:CCGGGAGTCAACAGACTCTCTACCACTCGAGTGGTAGAGAGTCTGTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1075s1c1
Sequence:CCGGGTCAACAGACTCTCTACCACTCTCGAGAGTGGTAGAGAGTCTGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1280s1c1
Sequence:CCGGGAAGAACCTGCACAACCCTATCTCGAGATAGGGTTGTGCAGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015209
KAZN MISSION shRNA shRNA Plasmid DNA
kazrin, periplakin interacting protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1273s1c1
Sequence:CCGGCAGTTCAGAAGAACCTGCACACTCGAGTGTGCAGGTTCTTCTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-729s1c1
Sequence:CCGGCGAGACTTCATCCGCAACTATCTCGAGATAGTTGCGGATGAAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1302s1c1
Sequence:CCGGGTACAGTCACTAGAGGATCTTCTCGAGAAGATCCTCTAGTGACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1292s1c1
Sequence:CCGGCAACCCTATTGTACAGTCACTCTCGAGAGTGACTGTACAATAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1295s1c1
Sequence:CCGGCCCTATTGTACAGTCACTAGACTCGAGTCTAGTGACTGTACAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1070s1c1
Sequence:CCGGGCAGAGTCAACAGACTCTCTACTCGAGTAGAGAGTCTGTTGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1073s1c1
Sequence:CCGGGAGTCAACAGACTCTCTACCACTCGAGTGGTAGAGAGTCTGTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1075s1c1
Sequence:CCGGGTCAACAGACTCTCTACCACTCTCGAGAGTGGTAGAGAGTCTGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1280s1c1
Sequence:CCGGGAAGAACCTGCACAACCCTATCTCGAGATAGGGTTGTGCAGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015209
KAZN MISSION shRNA Lentiviral Transduction Particles
kazrin, periplakin interacting protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166808    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1273s1c1
Sequence:CCGGCAGTTCAGAAGAACCTGCACACTCGAGTGTGCAGGTTCTTCTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164683    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-729s1c1
Sequence:CCGGCGAGACTTCATCCGCAACTATCTCGAGATAGTTGCGGATGAAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163756    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1302s1c1
Sequence:CCGGGTACAGTCACTAGAGGATCTTCTCGAGAAGATCCTCTAGTGACTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1292s1c1
Sequence:CCGGCAACCCTATTGTACAGTCACTCTCGAGAGTGACTGTACAATAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1295s1c1
Sequence:CCGGCCCTATTGTACAGTCACTAGACTCGAGTCTAGTGACTGTACAATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1070s1c1
Sequence:CCGGGCAGAGTCAACAGACTCTCTACTCGAGTAGAGAGTCTGTTGACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1073s1c1
Sequence:CCGGGAGTCAACAGACTCTCTACCACTCGAGTGGTAGAGAGTCTGTTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165571    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1075s1c1
Sequence:CCGGGTCAACAGACTCTCTACCACTCTCGAGAGTGGTAGAGAGTCTGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015209.1-1280s1c1
Sequence:CCGGGAAGAACCTGCACAACCCTATCTCGAGATAGGGTTGTGCAGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144531
KAZN MISSION shRNA Bacterial Glycerol Stock
kazrin, periplakin interacting protein
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144531.2-471s1c1
Sequence:CCGGCCCAGTTCAGAAGAGCCTATACTCGAGTATAGGCTCTTCTGAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144531.2-1118s1c1
Sequence:CCGGCCAAGAAGTTCCACCAAGTTACTCGAGTAACTTGGTGGAACTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144531.2-2342s1c1
Sequence:CCGGCCAGAATGAATGTGACTTCAACTCGAGTTGAAGTCACATTCATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144531.2-2510s1c1
Sequence:CCGGCGGAGGTGCAAATCCTACAAACTCGAGTTTGTAGGATTTGCACCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144531.2-1276s1c1
Sequence:CCGGGATATCGACCTGAAGGAGTATCTCGAGATACTCCTTCAGGTCGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144531.2-2435s1c1
Sequence:CCGGGCCTGTCATTAATCTGACAAACTCGAGTTTGTCAGATTAATGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144531
KAZN MISSION shRNA shRNA Plasmid DNA
kazrin, periplakin interacting protein
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144531.2-471s1c1
Sequence:CCGGCCCAGTTCAGAAGAGCCTATACTCGAGTATAGGCTCTTCTGAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144531.2-1118s1c1
Sequence:CCGGCCAAGAAGTTCCACCAAGTTACTCGAGTAACTTGGTGGAACTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144531.2-2342s1c1
Sequence:CCGGCCAGAATGAATGTGACTTCAACTCGAGTTGAAGTCACATTCATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144531.2-2510s1c1
Sequence:CCGGCGGAGGTGCAAATCCTACAAACTCGAGTTTGTAGGATTTGCACCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144531.2-1276s1c1
Sequence:CCGGGATATCGACCTGAAGGAGTATCTCGAGATACTCCTTCAGGTCGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144531.2-2435s1c1
Sequence:CCGGGCCTGTCATTAATCTGACAAACTCGAGTTTGTCAGATTAATGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144531
KAZN MISSION shRNA Lentiviral Transduction Particles
kazrin, periplakin interacting protein
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144531.2-471s1c1
Sequence:CCGGCCCAGTTCAGAAGAGCCTATACTCGAGTATAGGCTCTTCTGAACTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144531.2-1118s1c1
Sequence:CCGGCCAAGAAGTTCCACCAAGTTACTCGAGTAACTTGGTGGAACTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177836    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144531.2-2342s1c1
Sequence:CCGGCCAGAATGAATGTGACTTCAACTCGAGTTGAAGTCACATTCATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200069    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144531.2-2510s1c1
Sequence:CCGGCGGAGGTGCAAATCCTACAAACTCGAGTTTGTAGGATTTGCACCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144531.2-1276s1c1
Sequence:CCGGGATATCGACCTGAAGGAGTATCTCGAGATACTCCTTCAGGTCGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198382    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144531.2-2435s1c1
Sequence:CCGGGCCTGTCATTAATCTGACAAACTCGAGTTTGTCAGATTAATGACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks