EMAIL THIS PAGE TO A FRIEND

KBTBD3

kelch repeat and BTB (POZ) domain containing 3

Synonyms: BKLHD3
UniProtKB ID: Q8NAB2, Q6N066, Q86X38, Q96NK5
Gene ID:
Mouse(69149) kelch repeat and BTB (POZ) domain containing 3
Rat(315394) kelch repeat and BTB (POZ) domain containing 3
sheep(101115566) kelch repeat and BTB (POZ) domain containing 3
domestic guinea pig(100729929) kelch repeat and BTB (POZ) domain containing 3
naked mole-rat(101701415) kelch repeat and BTB (POZ) domain containing 3
Zebrafish(100003277) kelch repeat and BTB (POZ) domain containing 3
chicken(418976) kelch repeat and BTB (POZ) domain containing 3
domestic cat(101087263) kelch repeat and BTB (POZ) domain containing 3
cow(524207) kelch repeat and BTB (POZ) domain containing 3
Horse(100061596) kelch repeat and BTB (POZ) domain containing 3
dog(479456) kelch repeat and BTB (POZ) domain containing 3
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152433 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026962 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026962 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026962 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU070501 MISSION® esiRNA esiRNA human KBTBD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152433 Rosetta Predictions human pricing
NM_198439 Rosetta Predictions human pricing
NM_001108121 Rosetta Predictions rat pricing
NM_026962 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183522 predicted 1847
2 SASI_Hs01_00183523 predicted 1458
3 SASI_Hs01_00183524 predicted 812
4 SASI_Hs01_00183525 predicted 883
5 SASI_Hs02_00366172 predicted 1897
6 SASI_Hs01_00183526 predicted 1705
7 SASI_Hs02_00366173 predicted 1237
8 SASI_Hs01_00183529 predicted 1163
9 SASI_Hs01_00183530 predicted 1337
10 SASI_Hs01_00183531 predicted 1091
11 SASI_Hs01_00183527 predicted 1146
12 SASI_Hs01_00183528 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075234 predicted 2055
2 SASI_Hs01_00075235 predicted 1662
3 SASI_Hs01_00075236 predicted 1014
4 SASI_Hs01_00075237 predicted 1085
5 SASI_Hs02_00371948 predicted 2100
6 SASI_Hs01_00075238 predicted 1908
7 SASI_Hs02_00371949 predicted 1431
8 SASI_Hs01_00075241 predicted 1362
9 SASI_Hs01_00075242 predicted 1543
10 SASI_Hs01_00075243 predicted 1293
11 SASI_Hs01_00075239 predicted 1352
12 SASI_Hs01_00075240 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235564 predicted 933
2 SASI_Rn02_00235565 predicted 1438
3 SASI_Rn02_00235566 predicted 545
4 SASI_Rn02_00235567 predicted 1384
5 SASI_Rn02_00235568 predicted 1153
6 SASI_Rn02_00235569 predicted 1816
7 SASI_Rn02_00235570 predicted 900
8 SASI_Rn02_00235571 predicted 457
9 SASI_Rn02_00235572 predicted 1493
10 SASI_Rn02_00235573 predicted 1723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026962 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025332 predicted 1848
2 SASI_Mm01_00025333 predicted 1857
3 SASI_Mm01_00025334 predicted 1909
4 SASI_Mm01_00025335 predicted 2079
5 SASI_Mm01_00025336 predicted 1763
6 SASI_Mm01_00025338 predicted 874
7 SASI_Mm01_00025339 predicted 889
8 SASI_Mm02_00331280 predicted 804
9 SASI_Mm01_00025340 predicted 1526
10 SASI_Mm01_00025341 predicted 856
11 SASI_Mm01_00025337 predicted 1427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152433
KBTBD3 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152433.2-1158s1c1
Sequence:CCGGCAGGATCTAGTCTTTCGAGTTCTCGAGAACTCGAAAGACTAGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152433.2-3244s1c1
Sequence:CCGGCCTGCTTTACATCTCAGGTAACTCGAGTTACCTGAGATGTAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152433.2-2988s1c1
Sequence:CCGGCCAACTATAAAGCACTATGTTCTCGAGAACATAGTGCTTTATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152433.2-660s1c1
Sequence:CCGGCCAGTTTGTTTGATCATGCATCTCGAGATGCATGATCAAACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-1246s21c1
Sequence:CCGGCATAATCATGGATGCAATTAACTCGAGTTAATTGCATCCATGATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-710s21c1
Sequence:CCGGGGAAGTGTTACCATTACTAATCTCGAGATTAGTAATGGTAACACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-754s21c1
Sequence:CCGGATTTCTCGATTATGCCTATACCTCGAGGTATAGGCATAATCGAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-1754s21c1
Sequence:CCGGCCATTACCCAGAGGCATATACCTCGAGGTATATGCCTCTGGGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152433.3-2488s21c1
Sequence:CCGGGAATCCAGAATACTTAGTATTCTCGAGAATACTAAGTATTCTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-1636s21c1
Sequence:CCGGTATGGCTCTCGATAGATTATTCTCGAGAATAATCTATCGAGAGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-1506s21c1
Sequence:CCGGGAACGGTTCGACTGCATATTGCTCGAGCAATATGCAGTCGAACCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152433
KBTBD3 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152433.2-1158s1c1
Sequence:CCGGCAGGATCTAGTCTTTCGAGTTCTCGAGAACTCGAAAGACTAGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152433.2-3244s1c1
Sequence:CCGGCCTGCTTTACATCTCAGGTAACTCGAGTTACCTGAGATGTAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152433.2-2988s1c1
Sequence:CCGGCCAACTATAAAGCACTATGTTCTCGAGAACATAGTGCTTTATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152433.2-660s1c1
Sequence:CCGGCCAGTTTGTTTGATCATGCATCTCGAGATGCATGATCAAACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-1246s21c1
Sequence:CCGGCATAATCATGGATGCAATTAACTCGAGTTAATTGCATCCATGATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-710s21c1
Sequence:CCGGGGAAGTGTTACCATTACTAATCTCGAGATTAGTAATGGTAACACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-754s21c1
Sequence:CCGGATTTCTCGATTATGCCTATACCTCGAGGTATAGGCATAATCGAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-1754s21c1
Sequence:CCGGCCATTACCCAGAGGCATATACCTCGAGGTATATGCCTCTGGGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152433.3-2488s21c1
Sequence:CCGGGAATCCAGAATACTTAGTATTCTCGAGAATACTAAGTATTCTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-1636s21c1
Sequence:CCGGTATGGCTCTCGATAGATTATTCTCGAGAATAATCTATCGAGAGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-1506s21c1
Sequence:CCGGGAACGGTTCGACTGCATATTGCTCGAGCAATATGCAGTCGAACCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152433
KBTBD3 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152433.2-1158s1c1
Sequence:CCGGCAGGATCTAGTCTTTCGAGTTCTCGAGAACTCGAAAGACTAGATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152433.2-3244s1c1
Sequence:CCGGCCTGCTTTACATCTCAGGTAACTCGAGTTACCTGAGATGTAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158571    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152433.2-2988s1c1
Sequence:CCGGCCAACTATAAAGCACTATGTTCTCGAGAACATAGTGCTTTATAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152433.2-660s1c1
Sequence:CCGGCCAGTTTGTTTGATCATGCATCTCGAGATGCATGATCAAACAAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-1246s21c1
Sequence:CCGGCATAATCATGGATGCAATTAACTCGAGTTAATTGCATCCATGATTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-710s21c1
Sequence:CCGGGGAAGTGTTACCATTACTAATCTCGAGATTAGTAATGGTAACACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-754s21c1
Sequence:CCGGATTTCTCGATTATGCCTATACCTCGAGGTATAGGCATAATCGAGAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-1754s21c1
Sequence:CCGGCCATTACCCAGAGGCATATACCTCGAGGTATATGCCTCTGGGTAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152433.3-2488s21c1
Sequence:CCGGGAATCCAGAATACTTAGTATTCTCGAGAATACTAAGTATTCTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-1636s21c1
Sequence:CCGGTATGGCTCTCGATAGATTATTCTCGAGAATAATCTATCGAGAGCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152433.3-1506s21c1
Sequence:CCGGGAACGGTTCGACTGCATATTGCTCGAGCAATATGCAGTCGAACCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026962
KBTBD3 MISSION shRNA Bacterial Glycerol Stock
kelch repeat and BTB (POZ) domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026962.1-2122s1c1
Sequence:CCGGGCACACTGAAATGTTCCTTATCTCGAGATAAGGAACATTTCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026962.1-878s1c1
Sequence:CCGGCACATGGATTAAGTACAACTTCTCGAGAAGTTGTACTTAATCCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026962.1-719s1c1
Sequence:CCGGCCAGTTGTTCAGTCACACTTTCTCGAGAAAGTGTGACTGAACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026962.1-1974s1c1
Sequence:CCGGCCAAGAGCTTTAACTGAATTTCTCGAGAAATTCAGTTAAAGCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026962.1-1768s1c1
Sequence:CCGGCCACCTATAAGGTTTATAGTTCTCGAGAACTATAAACCTTATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026962
KBTBD3 MISSION shRNA shRNA Plasmid DNA
kelch repeat and BTB (POZ) domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026962.1-2122s1c1
Sequence:CCGGGCACACTGAAATGTTCCTTATCTCGAGATAAGGAACATTTCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026962.1-878s1c1
Sequence:CCGGCACATGGATTAAGTACAACTTCTCGAGAAGTTGTACTTAATCCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026962.1-719s1c1
Sequence:CCGGCCAGTTGTTCAGTCACACTTTCTCGAGAAAGTGTGACTGAACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026962.1-1974s1c1
Sequence:CCGGCCAAGAGCTTTAACTGAATTTCTCGAGAAATTCAGTTAAAGCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026962.1-1768s1c1
Sequence:CCGGCCACCTATAAGGTTTATAGTTCTCGAGAACTATAAACCTTATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026962
KBTBD3 MISSION shRNA Lentiviral Transduction Particles
kelch repeat and BTB (POZ) domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026962.1-2122s1c1
Sequence:CCGGGCACACTGAAATGTTCCTTATCTCGAGATAAGGAACATTTCAGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026962.1-878s1c1
Sequence:CCGGCACATGGATTAAGTACAACTTCTCGAGAAGTTGTACTTAATCCATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026962.1-719s1c1
Sequence:CCGGCCAGTTGTTCAGTCACACTTTCTCGAGAAAGTGTGACTGAACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026962.1-1974s1c1
Sequence:CCGGCCAAGAGCTTTAACTGAATTTCTCGAGAAATTCAGTTAAAGCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026962.1-1768s1c1
Sequence:CCGGCCACCTATAAGGTTTATAGTTCTCGAGAACTATAAACCTTATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks