EMAIL THIS PAGE TO A FRIEND

KCNA10

potassium voltage-gated channel, shaker-related subfamily, member 10

Synonyms: Kcn1 Kv1.8
UniProtKB ID: Q16322
Gene ID:
Human(3744) Summary: Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It is specifically regulated by cGMP and postulated to mediate the effects of substances that increase intracellular cGMP. This gene is intronless, and the gene is clustered with genes KCNA2 and KCNA3 on chromosome 1. [provided by RefSeq, Jul 2008]
Mouse(242151) potassium voltage-gated channel, shaker-related subfamily, member 10
Rat(295360) potassium voltage-gated channel, shaker-related subfamily, member 10
sheep(101111758) potassium voltage-gated channel, shaker-related subfamily, member 10
domestic guinea pig(100735330) potassium voltage-gated channel, shaker-related subfamily, member 10
naked mole-rat(101716990) potassium voltage-gated channel, shaker-related subfamily, member 10
chicken(395116) potassium voltage-gated channel, shaker-related subfamily, member 10
dog(490111) potassium voltage-gated channel, shaker-related subfamily, member 10
cow(538721) potassium voltage-gated channel, shaker-related subfamily, member 10
domestic cat(101083609) potassium voltage-gated channel, shaker-related subfamily, member 10
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015061 Anti-KCNA10 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV35178 Anti-KCNA10 antibody produced in rabbit IgG fraction of antiserum human, mouse, rat, guinea pig
immunohistochemistry, western blot pricing
SAB2101201 Anti-KCNA10 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, human, rat, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005549 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_143471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_143471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_143471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055161 MISSION® esiRNA esiRNA human KCNA10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005549 Rosetta Predictions human pricing
XM_001070427 Rosetta Predictions rat pricing
XM_227577 Rosetta Predictions rat pricing
NM_001081140 Rosetta Predictions mouse pricing
XM_143471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103169 predicted 1557
2 SASI_Hs01_00103170 predicted 995
3 SASI_Hs01_00103172 predicted 679
4 SASI_Hs01_00103173 predicted 1180
5 SASI_Hs01_00103174 predicted 1305
6 SASI_Hs01_00103175 predicted 696
7 SASI_Hs01_00103176 predicted 1208
8 SASI_Hs02_00339791 predicted 739
9 SASI_Hs02_00339792 predicted 894
10 SASI_Hs02_00339793 predicted 928
11 SASI_Hs01_00103167 predicted 976
12 SASI_Hs01_00103168 predicted 881
13 SASI_Hs01_00103171 predicted 1332
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331645 predicted 434
2 SASI_Rn02_00331646 predicted 570
3 SASI_Rn02_00331647 predicted 244
4 SASI_Rn02_00331648 predicted 614
5 SASI_Rn02_00331649 predicted 610
6 SASI_Rn02_00331650 predicted 424
7 SASI_Rn02_00331651 predicted 734
8 SASI_Rn02_00331652 predicted 739
9 SASI_Rn02_00331653 predicted 300
10 SASI_Rn02_00331654 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384522 predicted 443
2 SASI_Rn02_00384523 predicted 565
3 SASI_Rn02_00384524 predicted 243
4 SASI_Rn02_00384525 predicted 613
5 SASI_Rn02_00384526 predicted 612
6 SASI_Rn02_00384527 predicted 423
7 SASI_Rn02_00384528 predicted 730
8 SASI_Rn02_00384529 predicted 734
9 SASI_Rn02_00384530 predicted 326
10 SASI_Rn02_00384531 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295571 predicted 571
2 SASI_Mm02_00295572 predicted 242
3 SASI_Mm02_00295573 predicted 739
4 SASI_Mm02_00295574 predicted 1450
5 SASI_Mm02_00295575 predicted 735
6 SASI_Mm02_00295576 predicted 305
7 SASI_Mm02_00295577 predicted 749
8 SASI_Mm02_00295578 predicted 1213
9 SASI_Mm02_00295579 predicted 310
10 SASI_Mm02_00295580 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_143471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00265872 predicted 1457
2 SASI_Mm01_00265873 predicted 965
3 SASI_Mm01_00265874 predicted 1213
4 SASI_Mm01_00265875 predicted 882
5 SASI_Mm01_00265876 predicted 1205
6 SASI_Mm01_00265877 predicted 956
7 SASI_Mm01_00265878 predicted 1187
8 SASI_Mm01_00265879 predicted 1451
9 SASI_Mm01_00265880 predicted 1223
10 SASI_Mm01_00265881 predicted 1374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005549
KCNA10 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 10
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-848s1c1
Sequence:CCGGCCAGCCAATGTTCCCATTGATCTCGAGATCAATGGGAACATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-621s1c1
Sequence:CCGGCAGTGGTCCTAAATGAAGGAACTCGAGTTCCTTCATTTAGGACCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-998s1c1
Sequence:CCGGCTCCTCTTTGAGTACCCTGAACTCGAGTTCAGGGTACTCAAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-1337s1c1
Sequence:CCGGGCAACTCTCATCACAGAGCTACTCGAGTAGCTCTGTGATGAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-1592s1c1
Sequence:CCGGGAGTCCCATTTCTCTAGCATTCTCGAGAATGCTAGAGAAATGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005549.2-973s21c1
Sequence:CCGGCAATGACATCCACCGTCAGTTCTCGAGAACTGACGGTGGATGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005549.2-876s21c1
Sequence:CCGGCTGATGAAATCTCCTTCTATGCTCGAGCATAGAAGGAGATTTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005549.2-1813s21c1
Sequence:CCGGCATCCCAGGAGAAATTGAAAGCTCGAGCTTTCAATTTCTCCTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005549
KCNA10 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 10
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-848s1c1
Sequence:CCGGCCAGCCAATGTTCCCATTGATCTCGAGATCAATGGGAACATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-621s1c1
Sequence:CCGGCAGTGGTCCTAAATGAAGGAACTCGAGTTCCTTCATTTAGGACCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-998s1c1
Sequence:CCGGCTCCTCTTTGAGTACCCTGAACTCGAGTTCAGGGTACTCAAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-1337s1c1
Sequence:CCGGGCAACTCTCATCACAGAGCTACTCGAGTAGCTCTGTGATGAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-1592s1c1
Sequence:CCGGGAGTCCCATTTCTCTAGCATTCTCGAGAATGCTAGAGAAATGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005549.2-973s21c1
Sequence:CCGGCAATGACATCCACCGTCAGTTCTCGAGAACTGACGGTGGATGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005549.2-876s21c1
Sequence:CCGGCTGATGAAATCTCCTTCTATGCTCGAGCATAGAAGGAGATTTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005549.2-1813s21c1
Sequence:CCGGCATCCCAGGAGAAATTGAAAGCTCGAGCTTTCAATTTCTCCTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005549
KCNA10 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 10
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-848s1c1
Sequence:CCGGCCAGCCAATGTTCCCATTGATCTCGAGATCAATGGGAACATTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-621s1c1
Sequence:CCGGCAGTGGTCCTAAATGAAGGAACTCGAGTTCCTTCATTTAGGACCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-998s1c1
Sequence:CCGGCTCCTCTTTGAGTACCCTGAACTCGAGTTCAGGGTACTCAAAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-1337s1c1
Sequence:CCGGGCAACTCTCATCACAGAGCTACTCGAGTAGCTCTGTGATGAGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005549.2-1592s1c1
Sequence:CCGGGAGTCCCATTTCTCTAGCATTCTCGAGAATGCTAGAGAAATGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005549.2-973s21c1
Sequence:CCGGCAATGACATCCACCGTCAGTTCTCGAGAACTGACGGTGGATGTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005549.2-876s21c1
Sequence:CCGGCTGATGAAATCTCCTTCTATGCTCGAGCATAGAAGGAGATTTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005549.2-1813s21c1
Sequence:CCGGCATCCCAGGAGAAATTGAAAGCTCGAGCTTTCAATTTCTCCTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_143471
KCNA10 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-743s1c1
Sequence:CCGGCCAATGACTTTCACCGGCAATCTCGAGATTGCCGGTGAAAGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-1108s1c1
Sequence:CCGGGCAACCCTCATAACAGAGCTACTCGAGTAGCTCTGTTATGAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-646s1c1
Sequence:CCGGGCTGATGAGATCTCCTTCTATCTCGAGATAGAAGGAGATCTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-916s1c1
Sequence:CCGGCCCAGCATCAATACAAACAAACTCGAGTTTGTTTGTATTGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-306s1c1
Sequence:CCGGGAGAGTCCTTATCAGTGACAACTCGAGTTGTCACTGATAAGGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_143471
KCNA10 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-743s1c1
Sequence:CCGGCCAATGACTTTCACCGGCAATCTCGAGATTGCCGGTGAAAGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-1108s1c1
Sequence:CCGGGCAACCCTCATAACAGAGCTACTCGAGTAGCTCTGTTATGAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-646s1c1
Sequence:CCGGGCTGATGAGATCTCCTTCTATCTCGAGATAGAAGGAGATCTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-916s1c1
Sequence:CCGGCCCAGCATCAATACAAACAAACTCGAGTTTGTTTGTATTGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-306s1c1
Sequence:CCGGGAGAGTCCTTATCAGTGACAACTCGAGTTGTCACTGATAAGGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_143471
KCNA10 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-743s1c1
Sequence:CCGGCCAATGACTTTCACCGGCAATCTCGAGATTGCCGGTGAAAGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-1108s1c1
Sequence:CCGGGCAACCCTCATAACAGAGCTACTCGAGTAGCTCTGTTATGAGGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-646s1c1
Sequence:CCGGGCTGATGAGATCTCCTTCTATCTCGAGATAGAAGGAGATCTCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-916s1c1
Sequence:CCGGCCCAGCATCAATACAAACAAACTCGAGTTTGTTTGTATTGATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_143471.2-306s1c1
Sequence:CCGGGAGAGTCCTTATCAGTGACAACTCGAGTTGTCACTGATAAGGACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks