EMAIL THIS PAGE TO A FRIEND

KCNA6

potassium voltage-gated channel, shaker-related subfamily, member 6

Synonyms: HBK2 KV1.6
UniProtKB ID: P17658
Gene ID:
Human(3742) Summary: Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class. The coding region of this gene is intronless, and the gene is clustered with genes KCNA1 and KCNA5 on chromosome 12. [provided by RefSeq, Jul 2008]
Mouse(16494) potassium voltage-gated channel, shaker-related, subfamily, member 6
Rat(64358) potassium voltage gated channel, shaker related subfamily, member 6
Zebrafish(795490) potassium voltage-gated channel, shaker-related, subfamily, member 6
cow(539714) potassium voltage-gated channel, shaker-related subfamily, member 6
Horse(100051577) potassium voltage-gated channel, shaker-related subfamily, member 6
dog(486733) potassium voltage-gated channel, shaker-related subfamily, member 6
domestic cat(101093113) potassium voltage-gated channel, shaker-related subfamily, member 6
domestic guinea pig(100718638) potassium voltage-gated channel, shaker-related subfamily, member 6
Domestic Rabbit(100353348) potassium voltage-gated channel, shaker-related subfamily, member 6
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002235 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013568 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013568 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013568 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002235 Rosetta Predictions human pricing
XM_001067110 Rosetta Predictions rat pricing
XM_575671 Rosetta Predictions rat pricing
NM_013568 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092027 predicted 2704
2 SASI_Hs01_00092028 predicted 2592
3 SASI_Hs02_00333470 predicted 2584
4 SASI_Hs01_00092029 predicted 2584
5 SASI_Hs01_00092030 predicted 2487
6 SASI_Hs01_00092031 predicted 2288
7 SASI_Hs01_00092032 predicted 2616
8 SASI_Hs01_00092033 predicted 2112
9 SASI_Hs01_00092034 predicted 2596
10 SASI_Hs01_00092035 predicted 1665
11 SASI_Hs01_00092036 predicted 2540
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067110 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319858 predicted 2449
2 SASI_Rn02_00319859 predicted 2844
3 SASI_Rn02_00319860 predicted 2182
4 SASI_Rn02_00319861 predicted 3071
5 SASI_Rn02_00319862 predicted 3084
6 SASI_Rn02_00319863 predicted 2517
7 SASI_Rn02_00319864 predicted 3122
8 SASI_Rn02_00319865 predicted 2428
9 SASI_Rn02_00319866 predicted 1998
10 SASI_Rn02_00319867 predicted 2387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404067 predicted 3543
2 SASI_Rn02_00404068 predicted 3555
3 SASI_Rn02_00404069 predicted 3382
4 SASI_Rn02_00404070 predicted 3070
5 SASI_Rn02_00404071 predicted 3081
6 SASI_Rn02_00404072 predicted 3124
7 SASI_Rn02_00404073 predicted 3384
8 SASI_Rn02_00404074 predicted 3498
9 SASI_Rn02_00404075 predicted 3623
10 SASI_Rn02_00404076 predicted 3571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013568 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036047 predicted 1028
2 SASI_Mm01_00036048 predicted 1423
3 SASI_Mm01_00036049 predicted 1687
4 SASI_Mm01_00036050 predicted 1652
5 SASI_Mm01_00036051 predicted 1701
6 SASI_Mm01_00036052 predicted 512
7 SASI_Mm01_00036053 predicted 1100
8 SASI_Mm01_00036054 predicted 1401
9 SASI_Mm01_00036056 predicted 515
10 SASI_Mm02_00322307 predicted 909
11 SASI_Mm01_00036055 predicted 1111
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002235
KCNA6 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002235.3-2606s21c1
Sequence:CCGGCTATCAACCTTGTTGCTTAATCTCGAGATTAAGCAACAAGGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002235.3-2645s21c1
Sequence:CCGGTAATCCATCTAAGTGACATTTCTCGAGAAATGTCACTTAGATGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002235.3-1760s21c1
Sequence:CCGGCATTGACTTGGTGGCTATCTTCTCGAGAAGATAGCCACCAAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-1013s1c1
Sequence:CCGGGCTGCGCTTTGAGACACAATTCTCGAGAATTGTGTCTCAAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-1673s1c1
Sequence:CCGGGTGCATTGTCTGGTTCACTTTCTCGAGAAAGTGAACCAGACAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-2397s1c1
Sequence:CCGGAGCTACCTTCCTACACCACATCTCGAGATGTGGTGTAGGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-2062s1c1
Sequence:CCGGCTGACGATGACGATTCGCTTTCTCGAGAAAGCGAATCGTCATCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-1548s1c1
Sequence:CCGGGAAGACGATTCCTACACATTTCTCGAGAAATGTGTAGGAATCGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002235
KCNA6 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002235.3-2606s21c1
Sequence:CCGGCTATCAACCTTGTTGCTTAATCTCGAGATTAAGCAACAAGGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002235.3-2645s21c1
Sequence:CCGGTAATCCATCTAAGTGACATTTCTCGAGAAATGTCACTTAGATGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002235.3-1760s21c1
Sequence:CCGGCATTGACTTGGTGGCTATCTTCTCGAGAAGATAGCCACCAAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-1013s1c1
Sequence:CCGGGCTGCGCTTTGAGACACAATTCTCGAGAATTGTGTCTCAAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-1673s1c1
Sequence:CCGGGTGCATTGTCTGGTTCACTTTCTCGAGAAAGTGAACCAGACAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-2397s1c1
Sequence:CCGGAGCTACCTTCCTACACCACATCTCGAGATGTGGTGTAGGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-2062s1c1
Sequence:CCGGCTGACGATGACGATTCGCTTTCTCGAGAAAGCGAATCGTCATCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-1548s1c1
Sequence:CCGGGAAGACGATTCCTACACATTTCTCGAGAAATGTGTAGGAATCGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002235
KCNA6 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002235.3-2606s21c1
Sequence:CCGGCTATCAACCTTGTTGCTTAATCTCGAGATTAAGCAACAAGGTTGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416824    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002235.3-2645s21c1
Sequence:CCGGTAATCCATCTAAGTGACATTTCTCGAGAAATGTCACTTAGATGGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002235.3-1760s21c1
Sequence:CCGGCATTGACTTGGTGGCTATCTTCTCGAGAAGATAGCCACCAAGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-1013s1c1
Sequence:CCGGGCTGCGCTTTGAGACACAATTCTCGAGAATTGTGTCTCAAAGCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-1673s1c1
Sequence:CCGGGTGCATTGTCTGGTTCACTTTCTCGAGAAAGTGAACCAGACAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-2397s1c1
Sequence:CCGGAGCTACCTTCCTACACCACATCTCGAGATGTGGTGTAGGAAGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-2062s1c1
Sequence:CCGGCTGACGATGACGATTCGCTTTCTCGAGAAAGCGAATCGTCATCGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002235.2-1548s1c1
Sequence:CCGGGAAGACGATTCCTACACATTTCTCGAGAAATGTGTAGGAATCGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013568
KCNA6 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, shaker-related subfamily, member 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013568.6-1031s21c1
Sequence:CCGGACGCTATCCTTTATTACTATCCTCGAGGATAGTAATAAAGGATAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013568.6-2673s21c1
Sequence:CCGGATGGTGACACCAGTAGAATAGCTCGAGCTATTCTACTGGTGTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013568.6-2005s21c1
Sequence:CCGGACAATGACCACGGTAGGTTATCTCGAGATAACCTACCGTGGTCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013568.3-3484s1c1
Sequence:CCGGCCACCCATTAAATGAGAACATCTCGAGATGTTCTCATTTAATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013568.3-1819s1c1
Sequence:CCGGCATCGAGCTTATGCGGAGAAACTCGAGTTTCTCCGCATAAGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013568.3-378s1c1
Sequence:CCGGCTGCTGTAGTAGTGAGAGGTTCTCGAGAACCTCTCACTACTACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013568.3-804s1c1
Sequence:CCGGCGTCTCAGTATTGGTCATCCTCTCGAGAGGATGACCAATACTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013568.3-1136s1c1
Sequence:CCGGCGGCCTTCTTTCGCAATATCACTCGAGTGATATTGCGAAAGAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013568
KCNA6 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, shaker-related subfamily, member 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013568.6-1031s21c1
Sequence:CCGGACGCTATCCTTTATTACTATCCTCGAGGATAGTAATAAAGGATAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013568.6-2673s21c1
Sequence:CCGGATGGTGACACCAGTAGAATAGCTCGAGCTATTCTACTGGTGTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013568.6-2005s21c1
Sequence:CCGGACAATGACCACGGTAGGTTATCTCGAGATAACCTACCGTGGTCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013568.3-3484s1c1
Sequence:CCGGCCACCCATTAAATGAGAACATCTCGAGATGTTCTCATTTAATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013568.3-1819s1c1
Sequence:CCGGCATCGAGCTTATGCGGAGAAACTCGAGTTTCTCCGCATAAGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013568.3-378s1c1
Sequence:CCGGCTGCTGTAGTAGTGAGAGGTTCTCGAGAACCTCTCACTACTACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013568.3-804s1c1
Sequence:CCGGCGTCTCAGTATTGGTCATCCTCTCGAGAGGATGACCAATACTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013568.3-1136s1c1
Sequence:CCGGCGGCCTTCTTTCGCAATATCACTCGAGTGATATTGCGAAAGAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013568
KCNA6 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, shaker-related subfamily, member 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013568.6-1031s21c1
Sequence:CCGGACGCTATCCTTTATTACTATCCTCGAGGATAGTAATAAAGGATAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416484    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013568.6-2673s21c1
Sequence:CCGGATGGTGACACCAGTAGAATAGCTCGAGCTATTCTACTGGTGTCACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013568.6-2005s21c1
Sequence:CCGGACAATGACCACGGTAGGTTATCTCGAGATAACCTACCGTGGTCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069273    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013568.3-3484s1c1
Sequence:CCGGCCACCCATTAAATGAGAACATCTCGAGATGTTCTCATTTAATGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013568.3-1819s1c1
Sequence:CCGGCATCGAGCTTATGCGGAGAAACTCGAGTTTCTCCGCATAAGCTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013568.3-378s1c1
Sequence:CCGGCTGCTGTAGTAGTGAGAGGTTCTCGAGAACCTCTCACTACTACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013568.3-804s1c1
Sequence:CCGGCGTCTCAGTATTGGTCATCCTCTCGAGAGGATGACCAATACTGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013568.3-1136s1c1
Sequence:CCGGCGGCCTTCTTTCGCAATATCACTCGAGTGATATTGCGAAAGAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks