EMAIL THIS PAGE TO A FRIEND

KCNE1

potassium voltage-gated channel, Isk-related family, member 1

Synonyms: ISK JLNS JLNS2 LQT2/5 LQT5 MinK
UniProtKB ID: P15382, A5H1P2, Q8N709, Q91Z94
Gene ID:
Human(3753) Summary: The product of this gene belongs to the potassium channel KCNE family. Potassium ion channels are essential to many cellular functions and show a high degree of diversity, varying in their electrophysiologic and pharmacologic properties. This gene encodes a transmembrane protein known to associate with the product of the KVLQT1 gene to form the delayed rectifier potassium channel. Mutation in this gene are associated with both Jervell and Lange-Nielsen and Romano-Ward forms of long-QT syndrome. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Mouse(16509) potassium voltage-gated channel, Isk-related subfamily, member 1
Rat(25471) potassium voltage-gated channel, Isk-related family, member 1
chicken(427980) potassium voltage-gated channel, Isk-related family, member 1
dog(487743) potassium voltage-gated channel, Isk-related family, member 1
cow(528014) potassium voltage-gated channel, Isk-related family, member 1
domestic cat(493681) potassium voltage-gated channel, Isk-related family, member 1
sheep(101119094) potassium voltage-gated channel, Isk-related family, member 1
Domestic Rabbit(100126000) potassium voltage-gated channel, Isk-related family, member 1
domestic guinea pig(100135562) potassium voltage-gated channel, Isk-related subfamily, member 1
naked mole-rat(101704517) potassium voltage-gated channel, Isk-related family, member 1
108 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000219 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000219 Rosetta Predictions human pricing
NM_001127668 Rosetta Predictions human pricing
NM_001127669 Rosetta Predictions human pricing
NM_001127670 Rosetta Predictions human pricing
NM_012973 Rosetta Predictions rat pricing
NM_008424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152613 predicted 503
2 SASI_Hs01_00152614 predicted 592
3 SASI_Hs01_00152615 predicted 429
4 SASI_Hs01_00152616 predicted 502
5 SASI_Hs01_00152618 predicted 821
6 SASI_Hs01_00152619 predicted 817
7 SASI_Hs01_00152620 predicted 1216
8 SASI_Hs02_00302114 predicted 509
9 SASI_Hs01_00152621 predicted 847
10 SASI_Hs01_00152622 predicted 729
11 SASI_Hs01_00152617 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127668 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330084 predicted 460
2 SASI_Hs02_00330085 predicted 414
3 SASI_Hs02_00330086 predicted 289
4 SASI_Hs02_00330087 predicted 360
5 SASI_Hs02_00330088 predicted 689
6 SASI_Hs02_00330089 predicted 365
7 SASI_Hs02_00330090 predicted 682
8 SASI_Hs02_00330091 predicted 447
9 SASI_Hs02_00330092 predicted 1079
10 SASI_Hs02_00330093 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330094 predicted 434
2 SASI_Hs02_00330095 predicted 385
3 SASI_Hs02_00330096 predicted 265
4 SASI_Hs02_00330097 predicted 337
5 SASI_Hs02_00330098 predicted 661
6 SASI_Hs02_00330099 predicted 335
7 SASI_Hs02_00330100 predicted 654
8 SASI_Hs02_00330101 predicted 418
9 SASI_Hs02_00330102 predicted 1058
10 SASI_Hs02_00330103 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330104 predicted 654
2 SASI_Hs02_00330105 predicted 599
3 SASI_Hs02_00330106 predicted 481
4 SASI_Hs02_00330107 predicted 551
5 SASI_Hs02_00330108 predicted 877
6 SASI_Hs02_00330109 predicted 560
7 SASI_Hs02_00330110 predicted 867
8 SASI_Hs02_00330111 predicted 640
9 SASI_Hs02_00330112 predicted 1275
10 SASI_Hs02_00330113 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069553 predicted 351
2 SASI_Rn01_00069554 predicted 294
3 SASI_Rn01_00069556 predicted 285
4 SASI_Rn01_00069557 predicted 276
5 SASI_Rn01_00069558 predicted 284
6 SASI_Rn01_00069559 predicted 266
7 SASI_Rn01_00069561 predicted 308
8 SASI_Rn01_00069562 predicted 348
9 SASI_Rn02_00260577 predicted 315
10 SASI_Rn02_00260578 predicted 355
11 SASI_Rn01_00069555 predicted 250
12 SASI_Rn01_00069560 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201798 predicted 605
2 SASI_Mm01_00201799 predicted 743
3 SASI_Mm01_00201800 predicted 1041
4 SASI_Mm01_00201801 predicted 1078
5 SASI_Mm01_00201802 predicted 684
6 SASI_Mm01_00201804 predicted 836
7 SASI_Mm02_00313891 predicted 923
8 SASI_Mm01_00201805 predicted 324
9 SASI_Mm01_00201806 predicted 313
10 SASI_Mm01_00201807 predicted 885
11 SASI_Mm01_00201803 predicted 727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000219
KCNE1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Isk-related family, member 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-542s21c1
Sequence:CCGGTTCTTCACCCTGGGCATCATGCTCGAGCATGATGCCCAGGGTGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-625s21c1
Sequence:CCGGGTCCGATGCCTGGCAAGAGAACTCGAGTTCTCTTGCCAGGCATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-708s21c1
Sequence:CCGGACCATCTGGCCATAGAACAACCTCGAGGTTGTTCTATGGCCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000219.3-1377s21c1
Sequence:CCGGTACTGATACACCTACCTTATACTCGAGTATAAGGTAGGTGTATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-725s21c1
Sequence:CCGGCAACCCAACACACACCTTCCTCTCGAGAGGAAGGTGTGTGTTGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-640s21c1
Sequence:CCGGAGAGAAGGACAAGGCCTATGTCTCGAGACATAGGCCTTGTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-738s21c1
Sequence:CCGGACCTTCCTGAGACGAAGCCTTCTCGAGAAGGCTTCGTCTCAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000219.3-2909s21c1
Sequence:CCGGGGCACACGGACTGGCTATTTACTCGAGTAAATAGCCAGTCCGTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-687s21c1
Sequence:CCGGGGTCGTGCTATGTCGTTGAAACTCGAGTTTCAACGACATAGCACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-243s1c1
Sequence:CCGGCGACCCATTCAACGTCTACATCTCGAGATGTAGACGTTGAATGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-204s1c1
Sequence:CCGGGCTGAGCTACATCCGCTCCAACTCGAGTTGGAGCGGATGTAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-70s1c1
Sequence:CCGGCAGGAGACAGTTCAGCAGGGTCTCGAGACCCTGCTGAACTGTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-234s1c1
Sequence:CCGGGCACTCGAACGACCCATTCAACTCGAGTTGAATGGGTCGTTCGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-159s1c1
Sequence:CCGGCCTCATGGTACTGGGATTCTTCTCGAGAAGAATCCCAGTACCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000219
KCNE1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Isk-related family, member 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-542s21c1
Sequence:CCGGTTCTTCACCCTGGGCATCATGCTCGAGCATGATGCCCAGGGTGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-625s21c1
Sequence:CCGGGTCCGATGCCTGGCAAGAGAACTCGAGTTCTCTTGCCAGGCATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-708s21c1
Sequence:CCGGACCATCTGGCCATAGAACAACCTCGAGGTTGTTCTATGGCCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000219.3-1377s21c1
Sequence:CCGGTACTGATACACCTACCTTATACTCGAGTATAAGGTAGGTGTATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-725s21c1
Sequence:CCGGCAACCCAACACACACCTTCCTCTCGAGAGGAAGGTGTGTGTTGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-640s21c1
Sequence:CCGGAGAGAAGGACAAGGCCTATGTCTCGAGACATAGGCCTTGTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-738s21c1
Sequence:CCGGACCTTCCTGAGACGAAGCCTTCTCGAGAAGGCTTCGTCTCAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000219.3-2909s21c1
Sequence:CCGGGGCACACGGACTGGCTATTTACTCGAGTAAATAGCCAGTCCGTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-687s21c1
Sequence:CCGGGGTCGTGCTATGTCGTTGAAACTCGAGTTTCAACGACATAGCACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-243s1c1
Sequence:CCGGCGACCCATTCAACGTCTACATCTCGAGATGTAGACGTTGAATGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-204s1c1
Sequence:CCGGGCTGAGCTACATCCGCTCCAACTCGAGTTGGAGCGGATGTAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-70s1c1
Sequence:CCGGCAGGAGACAGTTCAGCAGGGTCTCGAGACCCTGCTGAACTGTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-234s1c1
Sequence:CCGGGCACTCGAACGACCCATTCAACTCGAGTTGAATGGGTCGTTCGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-159s1c1
Sequence:CCGGCCTCATGGTACTGGGATTCTTCTCGAGAAGAATCCCAGTACCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000219
KCNE1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Isk-related family, member 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-542s21c1
Sequence:CCGGTTCTTCACCCTGGGCATCATGCTCGAGCATGATGCCCAGGGTGAAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-625s21c1
Sequence:CCGGGTCCGATGCCTGGCAAGAGAACTCGAGTTCTCTTGCCAGGCATCGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-708s21c1
Sequence:CCGGACCATCTGGCCATAGAACAACCTCGAGGTTGTTCTATGGCCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256494    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000219.3-1377s21c1
Sequence:CCGGTACTGATACACCTACCTTATACTCGAGTATAAGGTAGGTGTATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-725s21c1
Sequence:CCGGCAACCCAACACACACCTTCCTCTCGAGAGGAAGGTGTGTGTTGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-640s21c1
Sequence:CCGGAGAGAAGGACAAGGCCTATGTCTCGAGACATAGGCCTTGTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-738s21c1
Sequence:CCGGACCTTCCTGAGACGAAGCCTTCTCGAGAAGGCTTCGTCTCAGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000219.3-2909s21c1
Sequence:CCGGGGCACACGGACTGGCTATTTACTCGAGTAAATAGCCAGTCCGTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000219.3-687s21c1
Sequence:CCGGGGTCGTGCTATGTCGTTGAAACTCGAGTTTCAACGACATAGCACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-243s1c1
Sequence:CCGGCGACCCATTCAACGTCTACATCTCGAGATGTAGACGTTGAATGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-204s1c1
Sequence:CCGGGCTGAGCTACATCCGCTCCAACTCGAGTTGGAGCGGATGTAGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-70s1c1
Sequence:CCGGCAGGAGACAGTTCAGCAGGGTCTCGAGACCCTGCTGAACTGTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-234s1c1
Sequence:CCGGGCACTCGAACGACCCATTCAACTCGAGTTGAATGGGTCGTTCGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000219.1-159s1c1
Sequence:CCGGCCTCATGGTACTGGGATTCTTCTCGAGAAGAATCCCAGTACCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008424
KCNE1 MISSION shRNA Bacterial Glycerol Stock
potassium voltage-gated channel, Isk-related family, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-388s1c1
Sequence:CCGGGCTGAGTTACATCCGATCCAACTCGAGTTGGATCGGATGTAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-513s1c1
Sequence:CCGGGAGCTTGCTATGTCATTGAAACTCGAGTTTCAATGACATAGCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-352s1c1
Sequence:CCGGGCTGGGCTTCTTCGGCTTCTTCTCGAGAAGAAGCCGAAGAAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-427s1c1
Sequence:CCGGCGACCCTTTCAACGTGTACATCTCGAGATGTACACGTTGAAAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-565s1c1
Sequence:CCGGCCTTCCTGAACTGAAGCCATTCTCGAGAATGGCTTCAGTTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008424
KCNE1 MISSION shRNA shRNA Plasmid DNA
potassium voltage-gated channel, Isk-related family, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-388s1c1
Sequence:CCGGGCTGAGTTACATCCGATCCAACTCGAGTTGGATCGGATGTAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-513s1c1
Sequence:CCGGGAGCTTGCTATGTCATTGAAACTCGAGTTTCAATGACATAGCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-352s1c1
Sequence:CCGGGCTGGGCTTCTTCGGCTTCTTCTCGAGAAGAAGCCGAAGAAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-427s1c1
Sequence:CCGGCGACCCTTTCAACGTGTACATCTCGAGATGTACACGTTGAAAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-565s1c1
Sequence:CCGGCCTTCCTGAACTGAAGCCATTCTCGAGAATGGCTTCAGTTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008424
KCNE1 MISSION shRNA Lentiviral Transduction Particles
potassium voltage-gated channel, Isk-related family, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-388s1c1
Sequence:CCGGGCTGAGTTACATCCGATCCAACTCGAGTTGGATCGGATGTAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-513s1c1
Sequence:CCGGGAGCTTGCTATGTCATTGAAACTCGAGTTTCAATGACATAGCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-352s1c1
Sequence:CCGGGCTGGGCTTCTTCGGCTTCTTCTCGAGAAGAAGCCGAAGAAGCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-427s1c1
Sequence:CCGGCGACCCTTTCAACGTGTACATCTCGAGATGTACACGTTGAAAGGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008424.2-565s1c1
Sequence:CCGGCCTTCCTGAACTGAAGCCATTCTCGAGAATGGCTTCAGTTCAGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks